لیست محصولات

×

آیا سوالی دارید؟ با ما تماس بگیرید.تلفن: (021)44260285(4 خط) - تلگرام: +989391127651

محصولات موجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 پرل شيشه ايي-250gr 250g 950,000 ایرانی
2 Nitric Acid 2.5lit 4,500,000 Scharlau
3 Copper Nitrate 250gr 2,500,000 Acros
4 Ammonium Sulfate 100G 1,800,000 Acros
5 فيلتر سرسرنگي 0.22 استریل تک عددي عدد 180,000 MS
6 مگنت سایز 2 65,000 None
7 پتري ديش 3.5 کشت سلول استريل عدد 350,000 Jetbiofil
8 پليت 4خانه نچسب استريل عدد 300,000 Jetbiofil
9 Serafol 2,500,000 Serafol
10 رک نوک زرد همراه نوک 450,000 چینی
11 رک نوک کريستالي خالي عدد 450,000 چینی
12 استراپر 250,000 None
13 شيشه رنگ آميزي لام 350,000 None
14 Rox I 40 ul 1,200,000 TaKaRa
15 فيلتر سرسرنگي 0.45 استریل تک عددي عدد 180,000 MS
16 دي سديم هيدروژن فسفات 1Kg Acros - None 3,950,000 Acros
17 Rox II - 100µl 1,200,000 TaKaRa
18 پليت 12 خانه استريل - None 190,000 SPL
19 Buffer H 1000 None 600,000 TaKaRa
20 Buffer BSA 1000 1ml 600,000 TaKaRa
21 Buffer Triton X100 1000 1ml 600,000 TaKaRa
22 Apa I 1005A 10000u 9,950,000 TaKaRa
23 BOD Cell Test (BSB) 1.00687.0001 50 T 9,800,000 Merck
24 Bgl I 1000 units 1020A 1000U 4,500,000 TaKaRa
25 Dra I AhaIII 4000u TakaRa 1037A 4000u 9,950,000 TaKaRa
26 Mbo I 1069A 1000u 7,500,000 TaKaRa
27 Paraffin 107300 1kg 4,500,000 Merck
28 Hydroxyurea 10872383-1G 1g 3,950,000 Molekula
29 EcoT22I (AvaIII) 1125A 2000 u 9,500,000 TaKaRa
30 BspT104 (Asu II, Nsp V) 1225A 2500 u 7,950,000 TaKaRa
31 Sodium Carbonate 131648 1kg 2,950,000 Panreac
32 Vindoline 13940871-5MG None 5,950,000 Molekula
33 Syringic acid 14539311-10g 10g 4,950,000 Molekula
34 Syringic acid 14539311-1g 1g 1,500,000 Molekula
35 Syringic acid 14539311-25g 25g 9,500,000 Molekula
36 Syringic acid 14539311-50g 50g 15,500,000 Molekula
37 Sillicon Cloride-500ml 201165000 500ml 8,950,000 Acros
38 Ribonuclease H (RNase H) 1000units TaKaRa 2150A 1000U 8,950,000 TaKaRa
39 Imidazole 21611083-100g 100g 4,950,000 Molekula
40 Dodecyl-beta-D-maltoside (DDM) 21771928-1G 1g 6,950,000 Molekula
41 رک نوک فیلتردار Rnase & Dnase free 0.5-10ul-Orange 2502000 None 800,000 Orange
42 رک نوک فیلتردار Rnase & Dnase free- 1-100ul- Orange 2502025 None 800,000 Orange
43 رک نوک فیلتردار Rnase & Dnase free 1000ul- Orange 2502041 None 980,000 Orange
44 نوک کریستالی Rnase&Dnase& pyrogen free-1000pcs- Orange 2502050 None 3,950,000 Orange
45 نوک زرد فیلتردارRnase & Dnase free-Orange 2502100 None 3,950,000 Orange
46 ميکرو تيوب 0.2 Rnse Free بسته 1000عددي Orange 25500 None 2,950,000 Orange
47 BcaBEST DNA Polymerase 300U 2770Q 300u 2,950,000 TaKaRa
48 پلیت 48خانه استریل Rnase & Dnase free-SPL 30048 None 190,000 SPL
49 pUC 19 DNA 3219 None 12,500,000 TaKaRa
50 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-10g 10g 2,950,000 Molekula
51 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-50g 50g 7,950,000 Molekula
52 100 bp DNA ladder 3407A 100 Rxns 16,950,000 TaKaRa
53 500 bp DNA ladder 3411A 50 µg 16,950,000 TaKaRa
54 Poly(vinyl alcohol)-25gr 363065-25G 25g 9,500,000 Sigma
55 4-Imidazolecarboxylic acid 425842 1gr 19,500,000 Sigma
56 DAB-Am-4,Polypropylenimine tetramine dendrimer, generation 1 460699 5ml 35,000,000 BioBasic
57 Curcumin-5g 49256996-5g None 4,500,000 Molekula
58 لوله فالکون 50 استريل RNase & DNase Freeبسته 25عددي 50050 None 975,000 SPL
59 ABTS (2.2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)diammonium salt) 51808824-1G 14,950,000 Molekula
60 Resveratrol 51852282-100MG None 4,500,000 Molekula
61 Tannic acid 52612564-100G 100g 3,500,000 Molekula
62 Tannic acid 52612564-250G 250g 6,500,000 Molekula
63 Tannic acid 52612564-50G 50g 2,500,000 Molekula
64 Resazurin sodium salt 56554686-1G 1g 3,950,000 Molekula
65 Fluorescamine 57916662-100MG 100mg 8,950,000 Molekula
66 Tet System Approved FBS 631107-50ML None 19,800,000 TaKaRa
67 Universal GenomeWalker 2.0 636405 None 180,000,000 TaKaRa
68 SeqAmp DNA Polymerase 638504 None 22,000,000 TaKaRa
69 CloneAmp HiFi PCR Premix 639298-50rxns None 5,500,000 TaKaRa
70 فلاسک کشت سلول 175cm فيلتردار استريل بسته5 عددي 71175 None 1,425,000 SPL
71 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-1G None 1,950,000 Molekula
72 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-5G 2,950,000 Molekula
73 1,3-Dibromopropane 803279-100ml 100ml 12,500,000 Sigma
74 Topotecan hydrochloride 85474031-25MG 25mg 25,000,000 Molekula
75 Quercetin 86015335-100mg None 3,950,000 Molekula
76 Quercetin 86015335-500mg None 8,500,000 Molekula
77 Catharanthine 89985253-5MG None 5,950,000 Molekula
78 SUPREC-01 (Rapid Recovery of DNA from Agarose Gels) 9040 100T 12,500,000 TaKaRa
79 پی پت 5 استریل-SPL 91005 None 30,000 SPL
80 پی پت 10 استریل-SPL 91010 None 58,000 SPL
81 10X Takara Taq Buffer (Mg2+ free) 9151AM-1ML None 1,950,000 TaKaRa
82 2X GC Buffer I 9154-1.5ml None 1,500,000 TaKaRa
83 GC Buffer II 9155 1.25ml 1,500,000 TaKaRa
84 Loading buffer 6X 9156 vials 950,000 TaKaRa
85 Loading buffer 10 X 9157 vials 950,000 TaKaRa
86 Esay Dilution 1 pak 9160 1ml 25,000,000 TaKaRa
87 Plant DNA Isolation Reagent 9194 100T 12,500,000 TaKaRa
88 NucleoCassette™ 941-0002 Pack 29,500,000 NucleoCassette
89 TBE buffer (Tris-Borate-EDTA), primix powder A0014 1PK 2,500,000 BioBasic
90 TAE buffer 25x solution A0023 1L 4,950,000 BioBasic
91 10X TBE A00269 500ML 1,950,000 BioBasic
92 TBS buffer . 10x Solution A0027-4L None 6,950,000 BioBasic
93 Arsenic(III) oxide A1010 25gr 9,500,000 Sigma
94 دی آمونیوم هیدروژن فسفات A2301 500gr 1,950,000 Applichem
95 Amoxicillin, trihydrate A762203 5gr 2,500,000 BioBasic
96 Abscisic acid (Dormin, ABA) (+) AB0001 100mg 6,950,000 BioBasic
97 Acetylcholine chloride AB0002 5G 2,500,000 BioBasic
98 ADA buffer disodium salt Ab0005-25g None 3,500,000 BioBasic
99 Alizarin yellow GG AB0011 25gr 1,950,000 BioBasic
100 Alizarin yellow R AB0012 25gr 1,950,000 BioBasic
101 Agarose M AB0013 50gr 4,500,000 BioBasic
102 Agarose B, low EEO AB0014 50 gr 5,500,000 BioBasic
103 Alkali blue 6B AB0016 25gr 3,600,000 BioBasic
104 Adenosine 5-triphosphate(ATP) disodium salt AB0020 5g 2,500,000 BioBasic
105 Ammonium bicarbonate AB0032 500gr 2,500,000 BioBasic
106 Ammonium bicarbonate AB0032-100G None 950,000 BioBasic
107 4-Aminoantipyrine AB0033-100G 100G 5,300,000 BioBasic
108 Ammonium bromide AB0057 250gr 2,950,000 BioBasic
109 Ammonium carbonate AB0058 500gr 2,550,000 BioBasic
110 Ammonium citrate, dibasic AB0059 500gr 3,300,000 BioBasic
111 Ammonium citrate, tribasic AB0060 250gr 2,250,000 BioBasic
112 Ampicillin, trihydrate AB0064-1G None 950,000 BioBasic
113 Ampicillin, trihydrate AB0064-5G None 2,500,000 BioBasic
114 Ammonium iron(II) sulfate hexahydrate AB0065 500gr 3,500,000 BioBasic
115 Ammonium molybdate tetrahydrate AB0067 50gr 1,500,000 BioBasic
116 Ammonium oxalate hydrate Ab0070-500g None 5,500,000 Molekula
117 D-Arabinose AB0071D 25G 4,500,000 BioBasic
118 L-Arabinose AB0071L 25gr 5,500,000 BioBasic
119 Ammonium phosphate, tribasic trihydrate AB0073 500G 2,500,000 BioBasic
120 Anthraquinone AB0087 25G 2,500,000 BioBasic
121 Anthrone AB0088 25gr 4,500,000 BioBasic
122 Anthrone AB0088-1G None 950,000 BioBasic
123 Anthrone AB0088-5g 1,500,000 BioBasic
124 L-Aspartic acid AB0091 250G 2,500,000 BioBasic
125 L-Arginine free base AB0205 100g 4,500,000 BioBasic
126 L-Arginine, monohydrochloride AB0206 500g 13,500,000 BioBasic
127 L-Arginine, monohydrochloride AB0206 100g 3,950,000 BioBasic
128 Acetamide AB0687-100g None 1,950,000 BioBasic
129 Acetosyringone AB1111 1g 7,500,000 BioBasic
130 N-Acetyl-D-glucosamine AB2245 25gr 2,500,000 BioBasic
131 Acriflavine hydrochloride AB4433 25G 3,950,000 BioBasic
132 N-Acetyl-L-Cysteine AB6697-5g None 1,950,000 BioBasic
133 Aniline AC1710 100ML 5,400,000 BioBasic
134 ADA buffer AD0003-25g None 2,950,000 BioBasic
135 ACES Ad0004-25g None 2,950,000 BioBasic
136 Acriflavine, neutral AD0009 25G 3,500,000 BioBasic
137 Adenine AD0013 25gr 2,950,000 BioBasic
138 L-Alanine AD0022 100gr 3,950,000 BioBasic
139 L-Alanine .SIZE.10G AD0022-10G 10g 950,000 BioBasic
140 L-Alanine .SIZE.50G AD0022-50G 50g 2,950,000 BioBasic
141 Adenine sulphate, dihydrate AD0028 25G 3,200,000 BioBasic
142 Amphotericin B AD0030P 1g 4,500,000 BioBasic
143 BSA Standard, 0.5mg/ml AD0069 2ml 1,500,000 BioBasic
144 Ammonium acetate ADB0032 500gr 2,250,000 BioBasic
145 Ammonium chloride ADB0034-250g None 1,300,000 BioBasic
146 Ammonium phosphate, dibasic ADB0040 500gr 4,350,000 BioBasic
147 Ammonium phosphate,  monobasic ADB0042 500gr 4,350,000 BioBasic
148 BSA Standard Solution AJ642.SIZE.1ML None 1,950,000 BioBasic
149 Ammonium acetate AR0032 500gr 2,550,000 BioBasic
150 AUTOCLAVE INDIcat_numberOR TAPES AT011.1ROLLS 1Rol 3,950,000 BioBasic
151 PFU DNA Polymerase, 5U/UL B0093 100u 5,950,000 BioBasic
152 PFU DNA POLYMERASE, 5U/UL.SIZE.500U B0093(D0090P)-500U None 19,500,000 BioBasic
153 Polyoxyethylene Lauryl Ether-35 (Brij 35) B0217-250G 250G 3,950,000 BioBasic
154 Bismuth (III) citrate B0466 100G 1,950,000 BioBasic
155 Imidazole – 4-carboxaldehyde 97% B25050 5gr 19,500,000 AlfaAesar
156 Bis-acrylamide BB0025 250gr 17,500,000 BioBasic
157 Bis-acrylamide BB0025 50g 3,950,000 BioBasic
158 Bis-acrylamide.SIZE.10G BB0025-10G None 1,300,000 BioBasic
159 Bromothymol blue, free acid BB0043 5G 1,650,000 BioBasic
160 BCIP toluidine salt BB0072 100MG 4,500,000 BioBasic
161 Bis-Tris BB0079 25gr 2,500,000 BioBasic
162 Bis-Tris BB0079-100gr 100gr 7,950,000 BioBasic
163 X-Gal BB0083 100mg 2,950,000 BioBasic
164 X-Gal BB0083.SIZE.5G 5gr 45,000,000 BioBasic
165 Bacitracin zinc BB0113 5g 2,950,000 BioBasic
166 Beef Extract BB0114-100g 100G 3,200,000 BioBasic
167 Barium acetate BB0116 250G 3,950,000 BioBasic
168 Benzamide BB0122 100gr 2,500,000 BioBasic
169 Benzimidazole BB0125 25gr 1,800,000 BioBasic
170 Berberine chloride BB0129.SIZE.5G None 4,500,000 BioBasic
171 BES, free acid BB0130 25G 2,700,000 BioBasic
172 BES, monosodium salt BB0131 25G 3,850,000 BioBasic
173 Betaine hydrochloride BB0133 250gr 4,950,000 BioBasic
174 Brilliant green BB0242 25gr 1,500,000 BioBasic
175 Bromocresol purple, free acid BB0244 25G 4,950,000 BioBasic
176 Bicine BB0266 100G 4,500,000 BioBasic
177 Bromocresol purple, sodium salt BB0627 5gr 1,500,000 BioBasic
178 6-Benzylamino purine BB0743-25G None 3,950,000 BioBasic
179 Basic fuchsin, certified BB1111 5gr 1,500,000 BioBasic
180 Benzoic acid BB1147 250gr 2,500,000 BioBasic
181 Bromophenol blue BB2230 25g 3,950,000 BioBasic
182 Benzaldehyde BC2140 500G 6,950,000 BioBasic
183 Bromothymol blue, sodium salt BD0048 5G 1,800,000 BioBasic
184 Bromocresol green, free acid BD0159 5G 2,950,000 BioBasic
185 1-Butanesulfonic acid sodium salt BD1237 5G 3,950,000 BioBasic
186 Bromophenol blue, sodium salt BDB0001 25g 4,500,000 BioBasic
187 تیوب 0.2میلی لیتر پی سی آر ، با درب صاف ،استریل،10 Rnase/DNase Free بسته 1000 BP541-S100 بسته 4,500,000 BioBasic
188 تیوب 0.2میلی لیتر پی سی آر ، با درب محدب ،استریل،10 Rnase/DNase Free بسته 1000 عددی BP542-S100 بسته 4,500,000 BioBasic
189 96 Well 2ml Deep Plate, Natural, Edge Filled, BR581-96N None 450,000 BioBasic
190 96 Well 2ml Deep Plate, Natural, Edge Filled, 10 P BR581-96N None 3,950,000 BioBasic
191 96 Well 2ml Deep Plate, Natural, Edge Filled, Sterile, 10 P BR581-96NS 96NS 4,950,000 BioBasic
192 EZ-10 Spin Column Total RNA Mini-preps Kit BS1361 50preps 9,950,000 BioBasic
193 DNA Blunting & Ligation Kit BS243-10 Preps None 7,950,000 BioBasic
194 EZ-10 Spin Column DNA Gel Extraction Kit BS353 50 preps 6,500,000 BioBasic
195 EZ-10Spin Column PCR Products Purification Kit 100preps BS364-100preps None 9,950,000 BioBasic
196 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS413 50preps 6,500,000 BioBasic
197 EZ-10 Spin Column animal DNA Mini-Preps Kit BS427 50preps 6,950,000 BioBasic
198 Fast DNA Ligation Kit(5U/UL,T4) 10RXN BS511-10RXN None 4,500,000 BioBasic
199 EZ-10 Spin Column Total RNA Mini-Preps Super Kit BS583 20preps 5,950,000 BioBasic
200 Penicillin / Streptomycin / Amphotericin B, sterile BS733 10ml 1,100,000 BioBasic
201 EZ-DNA Reagents BS8202 100 Preps 8,950,000 BioBasic
202 EZ-10 Spin Column Blood RNA Mini-Preps Kit BS82313 50preps 13,500,000 BioBasic
203 EZ-10 Spin Column Plant RNA Mini-Preps Kit BS82314 50preps 13,500,000 BioBasic
204 EZ-10 Spin Column Yeast DNA Mini-Preps Kit BS8257 50 PREPS 9,950,000 BioBasic
205 Rapid Bacteria RNA Isolation Kit BS8625 50preps 6,950,000 BioBasic
206 All-In-one DNA/RNA/Protein Miniprep Kit BS88003 50preps 18,500,000 BioBasic
207 EZ-10 DNAaway RNA Mini-Preps Kit BS88133-50 PREPS None 18,500,000 BioBasic
208 All-In-One DNA/RNA Miniprep Kit BS88203 50preps 16,500,000 BioBasic
209 One-4-ALL Genomic DNA Miniprep Kit BS88503 50preps 15,500,000 BioBasic
210  EZ-10 Total RNA Miniprep Kit BS88583 50preps 13,500,000 BioBasic
211 EZ-10 Spin Column RNA Cleanup & Concentration Kit.SIZE.50 Pre BS91315-50prep 50Prep 11,500,000 BioBasic
212 Membrane,Nuclear & CyToplasmic Protein Extraction Kit BSP002 50preps 13,950,000 BioBasic
213 One Step Plant Active Protein Extraction Kit BSP004-20PREPS None 12,000,000 BioBasic
214 TCA Protein Precipitation Kit BSP011-50 Preps None 5,950,000 BioBasic
215 Universal Protein Sediment Reagent BSP012-100 Preps None 5,950,000 BioBasic
216 Bacterial Protein Lysis Buffer, 1x Stength Solution BSP023-25ML None 4,500,000 BioBasic
217 رک سرسمپلرکریستالی کوتاه (10-1/0 میکرو لیتر)استریل رک 96 عددی BT215-RS رک 96 عددی 580,000 BioBasic
218 رک سرسمپلرکریستالی متوسط (10-2/0 میکرو لیتر)استریل رک 96 عددی Rnase/DNase Free BT216-RS رک 96 عددی 580,000 BioBasic
219 سرسمپلرکریستالی متوسط (10-2/0 میکرو لیتر)استریل Rnase/DNase Free BT216-S 1000pcs 1,800,000 BioBasic
220 0.2-10ul Micro Tips, MEDI,100/Pack,Sterile BT216-S-100 None 200,000 BioBasic
221 سرسمپلر آبی 1000-100میکرولیتر استریل-بسته 1000 عددی Rnase/DNase Free BT222-BS بسته 2,950,000 BioBasic
222 رک سر سمپلر آبی (100-1000) رک 100 خانه استریل RNase & DNase Free BT222-RS رک 100عددی 750,000 BioBasic
223 رک سر سمپلر زرد (200 میکرو لیتر) مدرج استریل Rnase/DNase Free BT224-RS , Rack BT224-RNS رک 96 عددی 600,000 BioBasic
224 سر سمپلر زرد (200 میکرو لیتر)مدرج استریل Rnase/DNase Free بسته هزار عددی BT224-YS بسته هزار عددی 1,950,000 BioBasic
225 رک سرسمپلرکریستالی (10-5/0 میکرو لیتر)استریل رک 96 عددی Rnase/DNase Free BT225-RS رک 96 عددی 580,000 BioBasic
226 سرسمپلرکریستالی بلند (10-5/0 میکرو لیتر)استریل بسته هزار عددی Rnase/DNase Free BT225-S 1000pcs 1,800,000 BioBasic
227 تیوب 65/0 میلی لیتر استریل ، بسته 1000 عددی Rnase/DNase Free BT613-NS 1000pcs 2,950,000 BioBasic
228 0.65ML TUBE, NATURAL,STERILE,100TUBES BT613-NS-100pcs None 350,000 BioBasic
229 تیوب 2 میلی لیتر ته مخروطی استریل  Rnase/DNase Free بسته 1000 عددی BT619-NS 1000pcs 3,950,000 BioBasic
230 2ML TUBE, NATURAL,STERILE,100TUBES BT619-NS-100pcs None 450,000 BioBasic
231 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G-100ul None 2,300,000 BioBasic
232 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G-200ul None 3,950,000 BioBasic
233 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G.500ul None 8,950,000 BioBasic
234 Caffeine .SIZE.25G C0150-25g None 1,500,000 BioBasic
235 Citric acid, monohydrate C2123 500gr 2,850,000 BioBasic
236 CAPS C2632 100gr 8,500,000 Sigma
237 Sodium citrate, trisodium salt, dihydrate CB0035 500gr 2,500,000 BioBasic
238 Sodium citrate, trisodium salt, dihydrate.SIZE.100G CB0035-100g None 950,000 BioBasic
239 Coomassie brilliant blue R-250    CB0037 5gr 2,500,000 BioBasic
240 Coomassie brilliant blue R-250.SIZE.1G CB0037-1G None 1,100,000 BioBasic
241 Coomassie brilliant blue G-250 CB0038-100G 100G 19,950,000 BioBasic
242 Coomassie brilliant blue G-250 CB0038-25G 25G 6,500,000 BioBasic
243 Coomassie brilliant blue G-250 CB0038-5G 5G 2,500,000 BioBasic
244 Calcium carbonate, anhydrous CB0052 500gr 2,500,000 BioBasic
245 L-Cystine CB0088-100G 100G 4,500,000 BioBasic
246 Cetyldimethylethyl ammonium bromide CB0105 100gr 4,500,000 BioBasic
247 CTAB .SIZE.25G CB0108-25G 25g 1,950,000 BioBasic
248 CHES CB0115 50gr 3,200,000 BioBasic
249 Chloramphenicol CB0118 250gr 17,500,000 BioBasic
250 Chloramphenicol CB0118 50gr 4,950,000 BioBasic
251 Chloramphenicol CB0118-10G 10G 2,500,000 BioBasic
252 Chloramphenicol CB0118-1G None 750,000 BioBasic
253 Chloramphenicol CB0118-5G None 1,500,000 BioBasic
254 L-Cysteine CB0132 100gr 3,950,000 BioBasic
255 L-Cysteine hydrochloride, monohydrate CB0133 100gr 3,300,000 BioBasic
256 L-Cysteine hydrochloride. monohydrate CB0133-500 None 14,000,000 BioBasic
257 Calcium acetate monohydrate CB0249 250gr 2,950,000 BioBasic
258 Calcium Hydroxide CB0256 500gr 3,950,000 BioBasic
259 Calcium nitrate. tetrahydrate CB0258-500g None 2,950,000 BioBasic
260 Calcium phosphate, dibasic, dihydrate CB0262 500gr 3,500,000 BioBasic
261 Calcium sulfate, dihydrate CB0265 500gr 3,950,000 BioBasic
262 Calcium sulfate, dihydrate CB0265-100g None 1,950,000 BioBasic
263 Calcium sulfate, dihydrate CB0265-50g None 1,200,000 BioBasic
264 L-Carnitine (Vitamin BT ) CB0272 25gr 3,950,000 BioBasic
265 D-(+) Cellobiose CB0278 5gr 6,500,000 BioBasic
266 4-Chloro-1-naphthol CB0293 10gr 3,950,000 BioBasic
267 Chlortetracycline, hydrochloride CB0297 25gr 4,200,000 BioBasic
268 Cholic acid CB0298-50g None 5,950,000 BioBasic
269 Choline chloride CB0299 100G 3,200,000 BioBasic
270 Ciprofloxacin hydrochloride CB0310 25g 3,850,000 BioBasic
271 Colchicine CB0322 100mg 4,950,000 BioBasic
272 Congo Red CB0324 50gr 3,500,000 BioBasic
273 Creatine hydrate CB0326 100G 2,950,000 BioBasic
274 Creatinine CB0328 5gr 1,500,000 Sigma
275 Creatinine CB0328-25G 25G 3,500,000 BioBasic
276 Crystal violet CB0331 25gr 1,950,000 BioBasic
277 CTAC , Cetyltrimethy lammonium chloride CB0332 100gr 3,950,000 BioBasic
278 CTAC, Cetyltrimethylammonium chloride CB0332-25g 25g 1,500,000 BioBasic
279 a-Cyclodextrin hydrate CB0348-5G 4,500,000 BioBasic
280 Cyclosporin A CB0352 250mg 3,950,000 BioBasic
281 STEM-CELLBANKER GMP grade-20ml CB046 20ml 4,950,000 TaKaRa
282 CELLOTION CB051  100ml 4,950,000 TaKaRa
283 Chitosan CB0660 500G 23,000,000 BioBasic
284 Chitosan CB0660 100gr 5,500,000 BioBasic
285 Chitosan .SIZE.50G CB0660-50g None 3,500,000 BioBasic
286 4-Chlorophenoxyacetic acid CB0720 100G 2,950,000 BioBasic
287 4-Chlorophenoxyacetic acid sodium salt CB0721 100G 2,950,000 BioBasic
288 Copper (II) acetate hydrate CB3050 100G 2,950,000 BioBasic
289 Casamino Acids CB3060 100gr 3,500,000 BioBasic
290 CASAMINO ACID CB3060-25g None 1,100,000 BioBasic
291 Copper (II) chloride hydrate CB3090 250G 3,600,000 BioBasic
292 Cresol red , sodium salt CD0037C 5gr 1,950,000 BioBasic
293 CHAPS CD0110 1gr 1,950,000 BioBasic
294 CHAPSO CD0113 1gr 2,950,000 BioBasic
295 Copper (II) sulfate pentahydrate CDB0063 500G 4,500,000 BioBasic
296 Copper (II) sulfate pentahydrate CDB0063-100G 100g 1,500,000 BioBasic
297 Carbenicillin disodium CDJ469-1g 1g 9,500,000 BioBasic
298 10/200mm Communis Chromatography ColUMns CH001.SIZE.1 5,400,000 BioBasic
299 10/300mm Communis Chromatography Columns CH002 10/30mm 5,950,000 BioBasic
300 10/400mm Communis Chromatography Columns CH003 10/400mm 6,950,000 BioBasic
301 10/500mm Communis Chromatography Columns CH004 10/500mm 7,500,000 BioBasic
302 16/200mm Communis Chromatography Columns CH007 16/200mm 6,950,000 BioBasic
303 16/300mm Communis Chromatography Columns CH008 16/300mm 7,950,000 BioBasic
304 CARRAGEENAN CN1138 500G 6,950,000 BioBasic
305 CARRAGEENAN CN1138-100g None 2,500,000 BioBasic
306 CARRAGEENAN CN1138-250g None 4,500,000 BioBasic
307 CARRAGEENAN CN1138-25g None 950,000 BioBasic
308 Calcium chloride, anhydrous CT1330 500G 3,600,000 BioBasic
309 Calcium chloride, anhydrous CT1330-250g None 2,200,000 BioBasic
310 Agarose A D0012-50g 50g 4,500,000 BioBasic
311 TSG DNA Polymerase, 5U/UL D0081 200u 3,500,000 BioBasic
312 Dimethyl sulfoxide (DMSO) D0231 500ml 3,950,000 BioBasic
313 Glyoxal, 40% solution D0238 1KG 4,950,000 BioBasic
314 Dialysis tubing cellulose membrane23mm غشاء دیالیز با قطر 23mm (Molecular weight cut-off : 12400Da) D0405 Meter 1,800,000 Sigma
315 Dialysis tubing cellulose membrane32mm غشاء دیالیز با قطر 32mm (Molecular weight cut-off : 12400Da) D0530 Meter 1,800,000 Sigma
316 Dialysis tubing cellulose membrane10mm غشاء دیالیز با قطر 10mm (Molecular weight cut-off : 14KDa) D9277 Meter 1,800,000 Sigma
317 Dialysis tubing cellulose membrane43mm غشاء دیالیز با قطر 43mm (Molecular weight cut-off : 14KDa) D9527 Meter 1,800,000 Sigma
318 2'-Deoxythymidine DB0049 1gr 1,950,000 BioBasic
319 DTT DB0058 5gr 7,950,000 BioBasic
320 DTT .SIZE.1G DB0058-1g None 3,500,000 BioBasic
321 DTNB DB0113 5gr 12,500,000 BioBasic
322 DTNB, 5,5'-Dithiobis-(2-nitrobenzoic acid) DB0113-1g None 4,500,000 BioBasic
323 DEAE, Dextran HCl-Form DB0147 10G 4,200,000 BioBasic
324 DEPC DB0154 5ml 4,500,000 BioBasic
325 DEPS DB0154-1ml None 1,950,000 BioBasic
326 2,4-Dichlorophenoxy acetic acid DB0166 100G 2,950,000 BioBasic
327 DNA & RNase Away™ DB0339 200ml 4,200,000 BioBasic
328 N-N-Dimethylglycine hydrochloride DB0412 25gr 1,950,000 BioBasic
329 DTAB,dodecyltrimethyl ammonium bromide DB0431-50G 50g 4,500,000 BioBasic
330 Doxycycline, hydrochloride DB0889-1g None 1,100,000 BioBasic
331 Doxycycline, hydrochloride DB0889-5g None 2,950,000 BioBasic
332 Diethylamine DC3320 500ML 7,950,000 BioBasic
333 dNTP mixture (10mM) DD0056 0.5ml 2,950,000 BioBasic
334 DIPSO free acid DD0166D 25G 3,300,000 BioBasic
335 2,7-Dichlorofluorescein DD1220 5G 3,950,000 BioBasic
336 Dimethylglyoxime sodium salt DD1221-100G 100g 2,950,000 BioBasic
337 Denaturing solution DE540 1L 2,950,000 BioBasic
338 Decyl-beta-D-glucopyranoside DJ574 100MG 2,950,000 BioBasic
339 DNAfectamine DNAF001-0.3ML None 16,950,000 BioBasic
340 Silica gel with moisture indicator DSG110-1KG None 3,750,000 BioBasic
341 Silica Gel Dryer DSG111-1PK None 2,950,000 BioBasic
342 Green-DNA Dye ,ready to use 0.5ml DT81414-0.5ML None 5,500,000 BioBasic
343 Eco-Red-DNA Dye . Ready to use DT81415-0.5ML None 5,500,000 BioBasic
344 Eco-Stain Plus . ready to use DT81418-1 ML 1ML 16,950,000 BioBasic
345 EDTA , free acid EB0107 500gr 3,500,000 BioBasic
346 Erythromycin EB0192 25gr 7,500,000 BioBasic
347 EDTA , Iron (III), sodium salt EB0437 100gr 3,500,000 BioBasic
348 Eosin Y, sodium salt EB0441 25G 1,950,000 BioBasic
349 Erythritol EB0444 100G 4,300,000 BioBasic
350 esculin, hydrate EB0452 5G 5,500,000 BioBasic
351 EDTA zinc (II), disodium salt EB6666 100G 3,300,000 BioBasic
352 EGTA ED0077 25g 5,950,000 BioBasic
353 Bromocresol green, sodium salt ED0087 5gr 2,950,000 BioBasic
354 Eosin Y, free acid EE0190 25gr 1,950,000 BioBasic
355 Eosin Y . free acid EE0190-100g None 4,950,000 BioBasic
356 Freund’s Adjuvant, Complete F5881 10ml 9,500,000 Sigma
357 Agar A FB0010-100G 100gr 2,500,000 BioBasic
358 Agar A FB0010-500G 500G 9,500,000 BioBasic
359 Agar B FB0012 100gr 2,700,000 BioBasic
360 Agar B FB0012 500G 9,950,000 BioBasic
361 Fluorescein, disodium salt FB0203 100G 2,950,000 BioBasic
362 Formamide deionized FB0211 100ml 2,950,000 BioBasic
363 D(-)-Fructose FB0213 500gr 1,950,000 BioBasic
364 Iron(II) sulfate . heptahydrate FB0461-100g None 1,500,000 BioBasic
365 Iron(II) sulfate . heptahydrate FB0461-50g None 900,000 BioBasic
366 Fluorescein, free acid FB0463 100G 2,950,000 BioBasic
367 Folic acid (Vitamin M) FB0466 25gr 9,500,000 BioBasic
368 Folic acid (Vitamin M) FB0466-5g None 4,950,000 BioBasic
369 5-Fluorouracil FD0080 5gr 3,950,000 BioBasic
370 Fluorene FD1223 50gr 2,950,000 BioBasic
371 نوک کریستالی فیلتردارRnase & Dnase free- GEB FT0010-B-N None 3,950,000 GEB
372 رک نوک فیلتردارRnase & Dnase free 10ul-GEB FT0010-R-NS None 800,000 GEB
373 نوک زرد فیلتردار Rnase & Dnase free- GEB FT0102-B-N None 3,950,000 GEB
374 رک نوک فیلتردارRnase & Dnase free 100ul-GEB FT0102-R-NS None 800,000 GEB
375 سرسمپلر فیلتردار شفاف 10- 1/0میکرولیتر بسته 1000 عددی FT215 1000pcs 4,950,000 BioBasic
376 رک سرسمپلر فیلتردار( 1000-100میکرولیتر) استریل رک 100 عددی  Rnase/DNase Free FT222-RS رک 100 خانه 980,000 BioBasic
377 رک سر سمپلر کریستالی فیلتردار(10-5/0میکرولیتر) استریل رک 96 عددی  Rnase/DNase Free FT225-RNS رک 96 عددی 800,000 BioBasic
378 Rapid Fungal DNA Isolation Kit FT71415 50preps 5,950,000 BioBasic
379 Rapid Fungal RNA Extraction Kit FT71416 50preps 6,950,000 BioBasic
380 Glucose oxidase G0243 50KU 11,000,000 BioBasic
381 Yeast Extract G0961 500gr 6,500,000 BioBasic
382 AGAR C G1253 100gr 1,950,000 BioBasic
383 Tryptone Powder G211(TG217) 100gr 2,500,000 BioBasic
384 TRYPTONE POWDER .SIZE.500G G211(TG217)-500 G 500g 8,500,000 BioBasic
385 Peptone E Gelatin Peptone G212 100gr 2,950,000 BioBasic
386 Peptone A From Meat G213 500G 7,950,000 BioBasic
387 Peptone A From Meat G213  100gr 1,950,000 BioBasic
388 Peptone D Protease Peptone G241 500G 8,950,000 BioBasic
389 Peptone D Protease Peptone G241 100gr 2,500,000 BioBasic
390 Agar D, Purified Agar G243 100G 5,500,000 BioBasic
391 Peptone F Lactalbumin Hydrolysate G256-100G None 2,500,000 BioBasic
392 PolyPeptone G258 100G 3,500,000 BioBasic
393 Peptone C Peptonized Milk G292 100G 1,950,000 BioBasic
394 Peptone C Peptonized Milk G292 500G 5,950,000 BioBasic
395 Glass beads G8772 10gr 4,800,000 Sigma
396 D(+)Galactose GB0215 100gr 4,950,000 BioBasic
397 Gentamycin sulfate   GB0217 1gr 1,500,000 BioBasic
398 Gentamycin sulfate GB0217 5gr 3,950,000 BioBasic
399 L-Glutamic acid GB0221 500gr 5,500,000 BioBasic
400 L-Glutamic acid GB0221-100g None 2,500,000 BioBasic
401 L-Glutamine GB0224 100gr 3,500,000 BioBasic
402 L-Glutamine GB0224-500G None 13,500,000 BioBasic
403 glycine GB0235 500 gr 4,950,000 BioBasic
404 Glycine.SIZE.100G GB0235-100G 100G 1,950,000 BioBasic
405 Guanosine-5'-triphosphate [GTP], 100 mM solution GB0332 0.25ml 4,350,000 BioBasic
406 Gallic acid GB0476 250g 5,500,000 BioBasic
407 Gallic acid GB0476-100G None 2,950,000 BioBasic
408 Giemsa stain    GB0477 10gr 2,500,000 BioBasic
409 Glucose-6-phosphate, disodium salt, hydrate GB0481-1g None 4,950,000 BioBasic
410 Guanosine GD0250 25gr 2,950,000 BioBasic
411 G 418 sulfate GDJ958 100mg 2,950,000 BioBasic
412 DNA Marker H2 50,100,150,200,250,300,400,500,600,700,800 900 GM345.SIZE.50 load None 5,950,000 BioBasic
413 HEPES, free acid HB0264 250gr 9,950,000 BioBasic
414 HEPES, free acid HB0264 50gr 3,500,000 BioBasic
415 HEPES free acid HB0264-1KG 1Kg 36,000,000 BioBasic
416 HEPES, sodium salt HB0265 50g 3,950,000 BioBasic
417 HEPES, sodium salt HB0265-250G None 11,000,000 BioBasic
418 L-Histidine, hydrochloride.SIZE.100G HB0330-100G None 3,950,000 BioBasic
419 L-Histidine, hydrochloride.SIZE.25G HB0330-25g None 1,100,000 BioBasic
420 Histamine dihydrochloride HB0501.SIZE.25G None 8,950,000 BioBasic
421 Histamine diphosphate HB0502 5gr 2,950,000 BioBasic
422 HOBT 1-Hydroxybenzotriazole monohydrate HB0511.SIZE.50G None 6,950,000 BioBasic
423 N-Hydroxysuccinimide-5G HB0526-5G None 1,500,000 BioBasic
424 8-Hydroxyquinoline (8-Quinolinol) HD0274-25g None 3,500,000 BioBasic
425 L-Histidine, monohydrochloride, monohydrate HE806 25gr 3,950,000 BioBasic
426 L-Histidine, monohydrochloride, HE806-5G None 1,400,000 BioBasic
427 ممبران استات سلولز بسته 100 عددی13 MM,0.45UM, 100/Box HP131 Pack 3,950,000 BioBasic
428 ممبران استات سلولز بسته 100 عددی 25 MM,0.45UM, 100/Box HP132 Pack 4,500,000 BioBasic
429 ممبران استات سلولز بسته 100 عددی 50 MM,0.45UM,100/Box HP133 Pack 4,950,000 BioBasic
430 Taq DNA Polymerase (High PURITY), 5U/UL HTD0078 200u 1,950,000 BioBasic
431 TAQ DNA POLYMERASE-500U HTD0078 None 3,950,000 BioBasic
432 Taq DNA Polymerase (High PURITY), 5U/UL HTD0078 1000U 6,500,000 BioBasic
433 4-Isothiocyanatophenyl α-D-Mannopyranoside I905135 95,000,000 TRC
434 رک 38 خانه میکروتیوب 1/5 سرماساز IB002A رک 38 عددی 1,950,000 BioBasic
435 IPTG IB0168 5gr 9,950,000 BioBasic
436 IPTG IB0168 1gr 2,950,000 BioBasic
437 INT dye IB0280 250mg 2,950,000 BioBasic
438 Indigo carmine  IB0532 10gr 1,950,000 BioBasic
439 D-myo-Inositol IB0536 100gr 3,950,000 BioBasic
440 Iodine IB0538 100gr 5,950,000 BioBasic
441 3-Indoleacetic acid (IAA) IB0723 25gr 3,950,000 BioBasic
442 3-Indole-acetic acid sodium salt IB0724 25gr 13,500,000 BioBasic
443 L-Isoleucine IB0914 50G 3,950,000 BioBasic
444 L-Isoleucine IB0914-250G 250g 12,500,000 BioBasic
445 Kanamycin sulfate KB0286 100G 29,500,000 BioBasic
446 Kanamycin sulfate KB0286 5g 2,950,000 BioBasic
447 Kanamycin sulfate 1g KB0286-1G None 950,000 BioBasic
448 Kanamycin sulfate.SIZE.25G KB0286-25G 25gr 8,500,000 BioBasic
449 Kanamycin sulfate 700mg KB0286-700mg None 850,000 BioBasic
450 Kinetin KB0745 100G 19,500,000 BioBasic
451 Kinetin KB0745 25gr 5,500,000 BioBasic
452 2-Ketoglutaric acid KD0290 100gr 4,500,000 BioBasic
453 Lysostaphin  from  Staphylococcus  staphyloly L7386-1MG 1mg 16,950,000 Sigma
454 Lincomycin hydrochloride LB0604-25G 25G 4,500,000 BioBasic
455 D-Lactose, monohydrate LC4280 500gr 4,950,000 BioBasic
456 Lysozyme .SIZE.5G LDB0308 7,950,000 BioBasic
457 Lysozyme LDB0308 1gr 2,950,000 BioBasic
458 Lysozyme LDB0308-25G 25G 34,000,000 BioBasic
459 Lysozyme 600mg LDB0308-600mg 600mg 2,100,000 BioBasic
460 500bp-10kb Ladder ready to use.SIZE.100 loading M101R-1-100 loading None 6,950,000 BioBasic
461 Lamda DNA / HindIII Marker, Ready to use7 DNA fragments : 23130*, 9416, 6557, 4361*, 2322, 2027 & 564 M104R-1 100 loading 3,500,000 BioBasic
462 100+50bpDNA Marker,Ready-to-use:11 DNA fragments:150,250,350,450,550,650,750,850,1000,1500bp M109-A 100 Loading 6,950,000 BioBasic
463 F8 monoclonal antibody, clone 101 MAB4180 100 ug 39,500,000 Abnova
464 Magnesium acetate, tetrahydrate MB0326 500gr 2,950,000 BioBasic
465 Magnesium chloride, hexahydrate MB0328 500gr 3,500,000 BioBasic
466 Magnesium chloride, hexahydrate.SIZE.100G MB0328-100G 100G 1,100,000 BioBasic
467 Manganese chloride, tetrahydrate MB0331 1KG 4,800,000 BioBasic
468 DL-Malic acid MB0333 250gr 1,500,000 BioBasic
469 Manganese sulfate, monohydrate MB0334 500G 3,600,000 BioBasic
470 D-Mannitol MB0335 100gr 1,950,000 BioBasic
471 MES, free acid, monohydrate MB0341 25gr 3,500,000 BioBasic
472 MES, free acid, monohydrate MB0341-5G 5G 1,500,000 BioBasic
473 Methylene blue, chloride, trihydrate.SIZE.50G MB0342 None 2,500,000 BioBasic
474 L-Methionine MB0346 25gr 3,950,000 BioBasic
475 Molybdic acid, sodium salt MB0358 50gr 2,950,000 BioBasic
476 D-Mannose MB0554 100G 12,000,000 BioBasic
477 Manganese acetate, tetrahydrate MB0600 250G 2,300,000 BioBasic
478 Menthol MB0608 50gr 3,200,000 BioBasic
479 Methylamine hydrochloride MB0613 100G 3,200,000 BioBasic
480 Methyl blue, sodium salt MB0614 50g 2,500,000 BioBasic
481 Methyl red  MB0627 25gr 2,500,000 BioBasic
482 Methyl red sodium salt MB0628 25G 2,950,000 BioBasic
483 Mycophenolic acid MB0640 1gr 3,950,000 BioBasic
484 MU-Gal MB1136 250mg 4,500,000 BioBasic
485 MgCl2 1.5ml MB1193-1.5ml 1.5ml 950,000 BioBasic
486 MUG MB2251-250MG 250mg 4,200,000 BioBasic
487 Malachite green oxalate MD0330 50G 1,950,000 BioBasic
488 Mucic acid MD1225 50gr 3,950,000 BioBasic
489 MOPSO, sodium salt MDB0095 25gr 2,950,000 BioBasic
490 MOPS, sodium salt MDB360S-5g None 1,500,000 BioBasic
491 Malt Extract MJ873(G257) 100gr 2,500,000 BioBasic
492 Magnesium sulfate, heptahydrate, biotech MRB0329 500gr 2,950,000 BioBasic
493 NADP N0760 250MG 6,950,000 BioBasic
494 L-Norleucine N2857 5G 5,950,000 BioBasic
495 L-Norvaline N4058 5G 1,950,000 BioBasic
496 Neomycin sulfate NB0366 25gr 4,950,000 BioBasic
497 Neomycin sulfate NB0366-5g None 1,950,000 BioBasic
498 Ninhydrin NB0378-1g None 950,000 BioBasic
499 Ninhydrin NB0378-5g None 1,950,000 BioBasic
500 Nystatin NB0390 5gr 3,950,000 BioBasic
501 NAD-Trihydrate NB0641 1gr 3,500,000 BioBasic
502 NADH disodium salt, trihydrate, Reduced NB0642 1gr 6,500,000 BioBasic
503 Neutral red NB0652 25gr 3,950,000 BioBasic
504 Neutral red NB0652-5g None 1,500,000 BioBasic
505 Nicotinamide NB0659 250gr 4,200,000 BioBasic
506 Nicotinic acid (NIACIN) NB0660 250gr 4,200,000 BioBasic
507 NON-Fat Powdered Milk NB0669 250g 4,500,000 BioBasic
508 β-Naphthoxyacetic acid NB0731 100gr 2,950,000 BioBasic
509 Nalidixic acid ND0363 25g 3,950,000 BioBasic
510 Nalidixic acid .SIZE.1G ND0363-1g None 950,000 BioBasic
511 Nalidixic acid .SIZE.5G ND0363-5g None 1,950,000 BioBasic
512 1-Nitro-2-naphthol-3,6 ND1226 25G 2,950,000 BioBasic
513 Nitrotetrazolium blue chloride (NBT) NDB0379 250mg 3,500,000 BioBasic
514 Nitrotetrazolium blue chloride (NBT) NDB0379 1gr 11,000,000 BioBasic
515 Nitrotetrazolium blue chloride (NBT).SIZE.800MG NDB0379-800mg None 9,500,000 BioBasic
516 Orange II O14Z25 25gr 1,950,000 BioBasic
517 Protein Standard 2mg/ml, Ovalbumin O715080 2ml 1,800,000 BioBasic
518 Ofloxacin OB0673-25G 25G 3,500,000 BioBasic
519 Orange G, sodium salt OB0674 25gr 2,950,000 BioBasic
520 Oxacillin, sodium salt OB0677-25G 25G 12,000,000 BioBasic
521 Oligo dT cellulose OB1142 100mg 3,950,000 BioBasic
522 L-Ornithine, monohydrochloride OB7771 25gr 2,950,000 BioBasic
523 Oil Red O OD0395 50g 3,300,000 BioBasic
524 Oxalic acid. dihydrate OD0400-250g None 2,500,000 BioBasic
525 Pyronin B P0724 5gr 4,350,000 BioBasic
526 pH Standard solution pH11.0 P2311 100ml 3,300,000 BioBasic
527 Polygalacturonic acid 85% 25gr Sigma P3889-25g None 17,500,000 Sigma
528 Polygalacturonic acid 85% 5gr Sigma P3889-5g None 4,500,000 Sigma
529 Trypsin (Bovine), Modified, Sequencing Grade P5320 4*25ug 12,500,000 Abnova
530 Penicillin G, sodium salt PB0135 100gr 9,500,000 BioBasic
531 Penicillin G, sodium salt PB0135 25gr 3,950,000 BioBasic
532 Penicillin G, sodium salt.SIZE.5G PB0135-5g None 1,950,000 BioBasic
533 Pepsin 1: 3000 PB0411-25g None 3,500,000 BioBasic
534 Phenol red PB0420 25gr 4,500,000 BioBasic
535 Phenol red PB0420-5G 5g 1,500,000 BioBasic
536 L-Phenylalanine.SIZE.50G PB0422-50gr 50g 2,950,000 BioBasic
537 PEG 4000 PB0431 500gr 3,500,000 BioBasic
538 PEG4000.SIZE.100G PB0431-100g None 1,100,000 BioBasic
539 PEG 6000 PB0432 500gr 3,500,000 BioBasic
540 Ponceau S PB0437 25gr 2,950,000 BioBasic
541 Potassium acetate PB0438 500gr 3,850,000 BioBasic
542 Potassium carbonate, anhydrate PB0439 500G 3,600,000 BioBasic
543 Potassium chloride PB0440 500gr 3,200,000 BioBasic
544 Potassium chloride PB0440-100G 100G 1,100,000 BioBasic
545 Potassium iodide   PB0443 50gr 2,950,000 BioBasic
546 Potassium phosphate, monobasic, anhydrous PB0445 500gr 3,950,000 BioBasic
547 Potassium Phosphat,Monobasic -100G PB0445-100G 100G 1,200,000 BioBasic
548 Potassium Phosphat,Monobasic -50G PB0445-50g None 850,000 BioBasic
549 Potassium sorbate PB0446 100gr 1,500,000 BioBasic
550 Potassium phosphate, dibasic, anhydrous PB0447 500gr 3,950,000 BioBasic
551 Proteinase K PB0451 50mg 4,950,000 BioBasic
552 Proteinase K .SIZE.250MG PB0451-250MG 250mg 19,500,000 BioBasic
553 Pancreatin-8.0 PB0681-100G 100g 5,950,000 BioBasic
554 D-Pantothenic acid hemicalcium salt (Vitamin B5) PB0683 100gr 3,950,000 BioBasic
555 Pluronic F-127 PB0750 100G 9,750,000 BioBasic
556 Potassium sulfate, anhydrous PB0782 500G 4,300,000 BioBasic
557 Protein A PB0789 10mg 5,500,000 BioBasic
558 L-Proline PB0923-100G 100gr 3,600,000 BioBasic
559 POPSO, disodium salt PB4959 25G 5,400,000 BioBasic
560 POPSO, free acid PB4979 25G 3,500,000 BioBasic
561 Potassium sulfite PB6688 500gr 4,300,000 BioBasic
562 Paraffin oil (Mineral oil), extra heavy PC5532-50ml None 1,100,000 BioBasic
563 Pyrogallol ( 1,2,3-Trihydroxybenzene) PC6880 100gr 8,500,000 BioBasic
564 10x Taq Buffer (MgCl2)1.5ml PCRB16-1.5ml 950,000 BioBasic
565 10x Taq Buffer (NH4)2SO4.SIZE.1.5ml PCRB55-1.5ML 950,000 BioBasic
566 10x Taq Buffer.SIZE.1.5ml PCRB60-1.5ml 1.5ml 950,000 BioBasic
567 Phenol red, sodium salt PD0424 25gr 3,200,000 BioBasic
568 PBS PD0435 1 tablet 85,000 BioBasic
569 Potassium ferricyanide PD0442 100gr 2,950,000 BioBasic
570 Propylene glycol ( 1,2-Propanediol) PD0450 500ml 1,950,000 BioBasic
571 Phosphotungstic acid hydrate PD1241 25gr 3,950,000 BioBasic
572 PIPES, sodium salt PDB0434 100G 7,800,000 BioBasic
573 Phosphatase Inhibitor Cocktail II PL019-1ml None 2,950,000 BioBasic
574 Proflavine hydrochloride PN1227 25G 5,950,000 BioBasic
575 Blotting Paper, 10x15cm, 100 SHEETS PP3322 None 9,500,000 BioBasic
576 Blotting Paper, 15x15cm, 100 SHEETS PP3323 None 9,950,000 BioBasic
577 Gel Blot Paper . 20x20 cm PP3324-1PK None 12,000,000 BioBasic
578 Potassium acetate.SIZE.500G PRB0438 3,950,000 BioBasic
579 Potassium bromide PT0762 500G 4,650,000 BioBasic
580 Potassium oxalate, monohydrate PT0774 500G 5,850,000 BioBasic
581 Potassium bicarbonate PT1195 500G 2,300,000 BioBasic
582 Rapid Plant RNA Isolation Kit PT4191 50preps 6,950,000 BioBasic
583 Quinine hemisulfate salt monohydrate QB0802 25G 4,500,000 BioBasic
584 Quinine sulfate, dihydrate QB0803 25G 3,300,000 BioBasic
585 Yeast Extract Qlab 500gr QB-39-5701 None 6,500,000 Qlab
586 Green-2-Go 2X qPCR-S Mastermix QPCR004-S-1.25ML None 6,950,000 BioBasic
587 Green-2-Go TaqProbe qPCR Mastermix-no Dye ) QPCR005-NODYE.1.25ML None 6,950,000 BioBasic
588 Green-2-Go 1-Step qRT-PCR Mastermix-No Dye (100X20ul Rxn) QPCR007-NODYE.100 None 28,000,000 BioBasic
589 Hs-ALPL-1-SG QuantiTect primer assay QT00012957 Pack 12,000,000 Qiagen
590 Hs-SPARC-1-SG QuantiTect primer assay QT00018620 Pack 12,000,000 Qiagen
591 Hs-RB1-1-SG QuantiTect primer assay QT00066899 Pack 12,000,000 Qiagen
592 Hs-BGLAP-1-SG QuantiTect primer assay QT00232771 Pack 12,000,000 Qiagen
593 Hs-SPP1-1-SG QuantiTect primer assay QT01008798 Pack 12,000,000 Qiagen
594 Taq DNA polymerase 50 unit R001Q None 3,950,000 TaKaRa
595 جعبه 5 خانه مخصوص تیوب سانتریفیوژ(تیوب 5/1 یا 2 میلی لیتر) R005-G Pack 400,000 BioBasic
596 جعبه 5 خانه مخصوص تیوب سانتریفیوژ (ویال شیشه ای 3 میلی لیتر) R006-G Pack 400,000 BioBasic
597 جعبه 5 خانه مخصوص تیوب سانتریفیوژ (ویال شیشه ای 10 میلی لیتر) R007-G Pack 400,000 BioBasic
598 TaKaRa Taq Hot Start 50 units R007Q None 4,950,000 TaKaRa
599 Rosaniline chloride R2770 25gr 2,500,000 BioBasic
600 کاور مخصوص رک 80 خانه دورو  بدون رنگ R567-C Pack 450,000 BioBasic
601 کاور مخصوص رک 96 خانه دورو  بدون رنگ R577-C Pack 450,000 BioBasic
602 رک میکروتیوب0.2درب لولایی رک153خانه- Globall Roll Rack0.2 None 300,000 Global Roll
603 رک میکروتیوب0.5درب لولایی رک98خانه- Globall Roll Rack0.5 None 300,000 Global Roll
604 رک میکروتیوب1.5درب لولایی رک72خانه- Globall Roll Rack1.5 None 300,000 Global Roll
605 Rhodamine B RB0464 100gr 3,950,000 BioBasic
606 RNase A RB0473 25mg 2,950,000 BioBasic
607 Rubidium chloride RB0668 25gr 16,500,000 BioBasic
608 Ribostamycin sulfate salt RB0807 5gr 3,200,000 BioBasic
609 Rifampicin RB0808 25g 8,950,000 BioBasic
610 Rifampicin RB0808-5G None 2,500,000 BioBasic
611 Rose Bengal, sodium salt RB0809 50gr 9,500,000 BioBasic
612 Rose Bengal, sodium salt RB0809-10G 10G 2,950,000 BioBasic
613 Rose Bengal, sodium salt RB0809-25gr 25gr 5,500,000 BioBasic
614 Rose Bengal, sodium sal RB0809-5G None 1,650,000 BioBasic
615 2 x RIPA Buffer I ( pH 7.4) 2 x concentrate RB4475 500ml 3,950,000 BioBasic
616 2 x RIPA Buffer II (Ph8.0)2x concentrate RB4476 500ml 3,950,000 BioBasic
617 Recombinant Vascular Endothelial Growth Factor165 RC216-16.SIZE.2UG None 9,750,000 BioBasic
618 Riboflavin 25g RD0470-25g None 1,950,000 BioBasic
619 D-Ribose RD0475 25gr 2,500,000 BioBasic
620 Sodium sulfate, anhydrate RD0489 2.5KG 8,550,000 BioBasic
621 Sodium sulfate, anhydrate RD0489-500G 500G 2,500,000 BioBasic
622 Raffinose, pentahydrate RJ392 25gr 5,500,000 BioBasic
623 TaKaRa EX Taq Hot Start 250 units RR006A None 22,000,000 TaKaRa
624 TaKaRa EX Taq Hot Start 50 units RR006Q None 5,950,000 TaKaRa
625 TaKaRa EX Taq Hot Start 20 units RR006Q-20U None 2,950,000 TaKaRa
626 Real Time one step RNA PCR kit, Version 2 RR026 100 Test 22,000,000 TaKaRa
627 TaKaRa LA Taq HS (dNTP inclus) RR042Q None 7,500,000 TaKaRa
628 SpeedSTAR™ HS DNA Polymerase RR070Q 50 Units 3,950,000 TaKaRa
629 سل شیشه ای با درب حجم 1.7 میلی لیتر به ابعاد45*12.5*7.5 میلیمتر S003-G Pack 1,500,000 BioBasic
630 سل شیشه ای با درب به ابعاد 45*12.5*12.5 میلیمتر با حجم 3.5 میلی متر S004-G Pack 1,500,000 BioBasic
631 Sodium thioglycolate S0265 25G 1,800,000 BioBasic
632 Sodium thioglycolate S0265-50g None 3,300,000 BioBasic
633 Sodium phosphate, dibasic, anhydrous.SIZE.100G S0404-100g None 1,500,000 BioBasic
634 Sudan black B S0593 5gr 1,500,000 BioBasic
635 Spermidine trihydrochloride S714272 5,500,000 BioBasic
636 Sodium sulfate, anhydrate SB0298 500G 1,800,000 BioBasic
637 Sodium chloride SB0476 1kg 1,950,000 BioBasic
638 Sodium chloride.SIZE.100g SB0476-100g None 550,000 BioBasic
639 Sodium chloride.SIZE.250G SB0476-250g None 900,000 BioBasic
640 Sodium chloride.SIZE.5KG SB0476-5KG 5kg 7,950,000 BioBasic
641 Sodium acetate, trihydrate SB0481 500g 1,950,000 BioBasic
642 Sodium bicarbonate SB0482 500g 1,800,000 BioBasic
643 Sodium acetate 3M solution SB0483 500ml 1,500,000 BioBasic
644 D-Sorbitol .SIZE.100G SB0491-100g None 850,000 BioBasic
645 Streptomycin sulfate SB0494 50gr 3,950,000 BioBasic
646 Streptomycin sulfate .SIZE.10G SB0494-10g None 1,500,000 BioBasic
647 Sucrose SB0498 500gr 1,800,000 BioBasic
648 Sucrose SB0498-2.5KG None 6,950,000 BioBasic
649 5-Sulfosalicylic acid, dihydrate SB0610 50gr 1,600,000 BioBasic
650 5-Sulfosalicylic acid, dihydrate SB0610 250gr 5,950,000 BioBasic
651 Sodium oxalate SB0829 500G 9,500,000 BioBasic
652 Sodium oxalate-250g SB0829-250g None 5,950,000 BioBasic
653 Sodium L-ascorbate SB0830 100gr 2,500,000 BioBasic
654 Sodium benzoate SB0833 500gr 3,950,000 BioBasic
655 Sodium bisulfite SB0834 500gr 2,950,000 BioBasic
656 Sodium bromide SB0837 250gr 2,950,000 BioBasic
657 Sodium butyrate SB0838 5gr 2,500,000 BioBasic
658 Sodium cholate, hydrate SB0841 25gr 3,950,000 BioBasic
659 Cromolyn sodium salt SB0843 5G 3,300,000 BioBasic
660 Sodium diphenylamine-4-sulfonate SB0847-10g None 9,500,000 BioBasic
661 Sodium diphenylamine-4-sulfonate SB0847-25g None 19,500,000 BioBasic
662 Sodium diphenylamine-4-sulfonate SB0847-5g None 4,950,000 BioBasic
663 Sodium metabisulfite SB0862 500gr 2,500,000 BioBasic
664 Sodium periodate SB0875 25gr 2,500,000 BioBasic
665 Sodium phosphate, monobasic, anhydrous SB0878 500gr 3,950,000 BioBasic
666 Sodium phosphate, monobasic, dihydrate SB0879 500gr 3,500,000 BioBasic
667 Sodium pyruvate SB0884 10gr 1,500,000 BioBasic
668 Sodium pyruvate SB0884 100gr 4,500,000 BioBasic
669 Sodium salicylate SB0885 250G 2,700,000 BioBasic
670 Sodium succinate, dibasic, hexahydrate SB0889 500G 6,300,000 BioBasic
671 Sodium Thiocyanate SB0897 250gr 2,950,000 BioBasic
672 Sorbic acid SB0899 500G 4,500,000 BioBasic
673 Spermine tetrahydrochloride SB0902 1gr 5,850,000 BioBasic
674 Starch soluble SB0904 500gr 3,750,000 BioBasic
675 Sudan IV (sudan Red 4) SB0914 25G 1,950,000 BioBasic
676 Sulfur sublimed SB0917 250gr 2,500,000 BioBasic
677 L-Serine SB1479 25gr 3,500,000 BioBasic
678 L-Serine SB1479-10G 10g 1,950,000 BioBasic
679 L-Serine SB1479-5G 5g 1,100,000 BioBasic
680 Sodium acetate, anhydrate SB1611 500gr 3,200,000 BioBasic
681 Saponin SB4521 25gr 2,600,000 BioBasic
682 Sodium Bismuthate SB7820 25gr 5,700,000 BioBasic
683 Sodium bisulfate, monohydrate SB7834 500G 2,950,000 BioBasic
684 Succinic anhydride SB7835-250g None 2,950,000 BioBasic
685 Sodium phosphate, tribasic, dodecahydrate SC8240-500g None 3,950,000 BioBasic
686 فلاسک کشت سلول75cmفیلتردار استریل-Sorfa SCF12250 None 950,000 Sorfa
687 Sodium thiosulfate, pentahydrate SD0256 500gr 3,500,000 BioBasic
688 Sodium thiosulfate, pentahydrate SD0256-100g None 1,100,000 BioBasic
689 Sodium borate, decahydrate SD0480-100g None 1,100,000 BioBasic
690 Succinic acid SD0496 500gr 4,500,000 BioBasic
691 Succinic acid SD0496-100g None 2,100,000 BioBasic
692 پلیت DNA 96 خانه با غشاء(960 میکرو مول) SD5007 plate 2,100,000 BioBasic
693 LB Agar Broth SD7003(S519) 250gr 3,950,000 BioBasic
694 LB AGAR BROTH SD7003(S519)-100g None 2,500,000 BioBasic
695 LB AGAR BROTH SD7003(S519)-50g None 1,500,000 BioBasic
696 LB-Top Agar SD7004-250g None 3,950,000 BioBasic
697 LB Lennox Agar SD7006-250g None 3,950,000 BioBasic
698 SOB BROTH.SIZE.250G SD7007 None 3,950,000 BioBasic
699 Sob Agar SD7008 250gr 3,950,000 BioBasic
700 NZCYM Broth SD7010 100G 2,600,000 BioBasic
701 NZCYM Agar SD7011 100G 2,600,000 BioBasic
702 NZYM Broth SD7012 100G 2,300,000 BioBasic
703 NZYM Agar SD7013 100G 2,600,000 BioBasic
704 NZM Broth SD7014 100G 2,300,000 BioBasic
705 NZM Agar SD7015 100G 2,600,000 BioBasic
706 YT Broth SD7016-250g None 3,950,000 BioBasic
707 YT Agar SD7017-250g None 4,500,000 BioBasic
708 2x YT Agar SD7020-250g None 3,950,000 BioBasic
709 2x YT Top Agar SD7021-250g None 3,950,000 BioBasic
710 YPD Broth SD7022-250g None 3,950,000 BioBasic
711 YPD Agar SD7023-250g None 3,950,000 BioBasic
712 M9 Medium SD7024 250G 3,950,000 BioBasic
713 YM Medium SD7031 250G 3,950,000 BioBasic
714 YM Agar SD7034 250G 4,950,000 BioBasic
715 TERRIFIC BROTH.SIZE.250G SD7035(DJ980) None 3,950,000 BioBasic
716 EDTA 0.5M sterile solution SD8135 450ml 3,950,000 BioBasic
717 Sodium lauroyl sarcosine SDB0486-50g None 1,950,000 BioBasic
718 Sodium phosphate, dibasic, heptahydrate.SIZE.100G SDB0487-100G 100G 1,100,000 BioBasic
719 Sodium carbonate, anhydrous SDB0615 500g 2,500,000 BioBasic
720 Sodium carbonate,anhydrous 2.5kg SDB0615 8,950,000 BioBasic
721 Sodium carbonate, anhydrous.SIZE.100G SDB0615-100g None 950,000 BioBasic
722 Sudan Red 7 B SJ227 10gr 3,300,000 BioBasic
723 Sulfobetaine 8 SJ547 1gr 2,950,000 BioBasic
724 Sulfobetaine 10 SJ548 1gr 3,200,000 BioBasic
725 Sulfobetaine 12 SJ550 1gr 3,200,000 BioBasic
726 EZ-10 Spin Column Blood Genomic DNA MiniPreps Kit SK8253 50preps 7,500,000 BioBasic
727 EZ-10 Spin Column Plant Genomic DNA Mini-Preps Kit SK8262 100 PREPS 13,950,000 BioBasic
728 SanPrep Column microRNA Mini-Preps Kit SK8811 50PRES 11,000,000 BioBasic
729 سل کوارتز UV استاندارد با درب تفلونی دو طرف مات با ابعاد 45*12.5*12.5 و حجم 3.5 میلی لیتر SQ014 Pack 13,500,000 BioBasic
730 سل کوارتز با درب ساده 4 طرف مات به ابعاد 45*12.5*12.5 میلیمتر با حجم 0.7 میلی لیتر UV میکرو SQ244 عدد 7,500,000 BioBasic
731 سل کوارتز با درب تفلونی 4 طرف مات به ابعاد 45*12.5*12.5 میلیمتر و حجم 1.4 میلی لیتر UV سمی میکرو SQ294 عدد 11,000,000 BioBasic
732 Sodium acetate SRB1611 500gr 3,500,000 BioBasic
733 GDF9 human 20ug Sigma SRP4872 None 55,000,000 Sigma
734 Thiazoyl blue tetrazolium bromide (MTT) T0793-500mg 500mg 4,950,000 BioBasic
735 Retro Nectin Dish 1 plate T110A None 4,950,000 TaKaRa
736 Tris-(hydroxymethyl) propane T1491-100g None 4,950,000 BioBasic
737 TNBT (Titanium(IV) butoxide) T6756 250MG 6,950,000 BioBasic
738 Western BLoT Immuno Booster Sample T7111Q 20ml 1,950,000 TaKaRa
739 Western BLoT Rapid Detect Sample T7121Q 2test 2,950,000 TaKaRa
740 Trimethoprim T714206 5g 6,500,000 BioBasic
741 Trimethoprim T714206-1G None 2,950,000 BioBasic
742 One-Tube Swab DNA Extraction Kit T71612 20preps 3,950,000 BioBasic
743 PBS T900 1Tablets 95,000 TaKaRa
744 Tris-Glycine-SDS powder T901 Pack 550,000 TaKaRa
745 Tris Glycin powder T902 Pack 450,000 TaKaRa
746 L-broth powder T904 Pack 550,000 TaKaRa
747 Tris hydrochloride TB0103 250gr 4,500,000 BioBasic
748 TES, sodium salt TB0124 25G 3,600,000 BioBasic
749 Tris  TB0194 2.5kg 25,500,000 BioBasic
750 Tris  TB0194 500gr 5,500,000 BioBasic
751 Tris TB0194-100g None 1,950,000 BioBasic
752 Tris TB0194-50g None 1,100,000 BioBasic
753 Triton X-100 TB0198 500ml 2,500,000 BioBasic
754 TMB dihydrochloride TB0514 1gr 4,500,000 BioBasic
755 TMB dihydrochloride.SIZE.5G TB0514 None 17,500,000 BioBasic
756 Polyoxyethylene-20 (TWEEN 20) TB0560 500ml 2,950,000 BioBasic
757 2,3,5-Triiodobenzoic acid TB0735 5gr 2,950,000 BioBasic
758 L-Threonine TB0919 100gr 4,500,000 BioBasic
759 TAPS, sodium salt TB0920 50G 4,500,000 BioBasic
760 L-Tartaric acid TB0925 500G 7,950,000 BioBasic
761 Taurine TB0926 100gr 3,950,000 BioBasic
762 TES, free acid TB0927 50G 5,400,000 BioBasic
763 Thymine TB0943-100g None 7,500,000 BioBasic
764 Thymol blue, free acid TB0944 25G 5,950,000 BioBasic
765 Thymolphthalein TB0945 25G 4,800,000 BioBasic
766 Thymol TB0946 25gr 3,300,000 BioBasic
767 Tiron TB0951 25G 4,950,000 BioBasic
768 Toluidine Blue O TB0962 5G 2,950,000 BioBasic
769 L-Tryptophan TB1911-1g None 850,000 BioBasic
770 L-Tryptophan TB1911-5g None 1,750,000 BioBasic
771 L-Tryptophan TB1911-800mg None 750,000 BioBasic
772 L-Tyrosine TB1932-5G None 950,000 BioBasic
773 TAPS, free acid TB3566 50G 2,950,000 BioBasic
774 1.5ML CONICAL TUBE WITH SCREWCAP, AMBER,500/BAG TC157-A 500/BAG 4,950,000 BioBasic
775 Tris acetate TD0101-25gr 25gr 1,600,000 BioBasic
776 Culture Tube, 12 ml, Natural, Dual Cap, Sterile TD444-S.SIZE.1PK None 1,800,000 BioBasic
777 Triton X-114.SIZE.500ML TDB0554 500ml 3,200,000 BioBasic
778 1.5ML SKIRTED TUBE WITH SCREWCAP, STERILE, NATURAL,500/BAG TK352-SN None 4,950,000 BioBasic
779 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, BLUE,500/BAG TK353-SB None 4,950,000 BioBasic
780 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, RED,500/BAG TK354-SR None 4,950,000 BioBasic
781 1.5ML Skirted Tube With Screw Cap, Amber, 500/Bag TK357-A بسته 6,950,000 BioBasic
782 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, GREEN,500/BAG TK357-SG None 4,950,000 BioBasic
783 Thymol blue, sodium salt TN1195 25G 6,950,000 BioBasic
784 Triton X-405 TS4449 100ML 4,500,000 BioBasic
785 غلطک پلیت با دسته چوبی TSM113 Pack 1,400,000 BioBasic
786 Uracil UD0564 100gr 3,500,000 BioBasic
787 Uridine UD0570 25gr 8,500,000 BioBasic
788 Uridine UD0570-5g None 3,950,000 BioBasic
789 L-Valine VB0172 500G 21,000,000 BioBasic
790 L-Valine 100G VB0172-100G 100G 4,950,000 BioBasic
791 L-Valine 250G VB0172-250G 250G 13,500,000 BioBasic
792 Vancomycin hydrochloride VB0983 1g 7,500,000 BioBasic
793 Victoria blue B VB0985 25gr 2,950,000 BioBasic
794 Rapid Viral RNA Extraction Kit VT4184 50preps 16,500,000 BioBasic
795 Wright's stain (Eosin methyl blue) WB0989 25gr 5,500,000 BioBasic
796 Xylene cyanol FF XB0005-5G 5G 2,500,000 BioBasic
797 Xylenol orange XB0996 10G 6,950,000 BioBasic
798 Xylitol XB0997 100gr 2,500,000 BioBasic
799 بطری پلاستیکی برای شستشو/درب آبی-قابل اتوکلاو(پی ست) XP001 Pack 550,000 BioBasic
800 Zymosan A ZB4250 100 mg 5,950,000 BioBasic

محصولات ناموجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 پنبه غیر استریل بسته ناموجود ایرانی
2 Bis Acrylamid 25g ناموجود Acros
3 Chloroform 1lit ناموجود Merck
4 Prime STAR (high fidelity PCR) 50 u None ناموجود TaKaRa
5 پي پت پاستور شيشه اي بلند 250عددي None ناموجود None
6 صفحه مخصوص لام ناموجود None
7 سمپلر متغيير 500 الي 5000 Unit ناموجود None
8 آب اکسیژنه 2.5lit ناموجود Merck
9 گلايسين 50gr ايراني ناموجود ایرانی
10 Buffer Z None ناموجود TaKaRa
11 Buffer MgSo4 None ناموجود TaKaRa
12 Iso Propanol 2.5lit ناموجود Applichem
13 perl ناموجود None
14 tris ايراني None ناموجود ایرانی
15 Buffer Taq*10 None ناموجود TaKaRa
16 بشر 600 سي سي None ناموجود None
17 بشر1000 سي سي None ناموجود None
18 Sodium Hydroxide 1KG ناموجود Merck
19 Acrylamide 100g ناموجود Acros
20 رک کرايوتيوب 1.8 Pack ناموجود چینی
21 پليت ته صاف 96 خانه استريل ST plate ناموجود None
22 فلاسک T75 بسته 5عددي فيلتر دار Biofil کانادا 5 pcs ناموجود Jetbiofil
23 کلريد سديم-امينسان ناموجود ایرانی
24 پليت 6 خانه کشت سلول استريل plate ناموجود None
25 سنتز پرايمر Page 100nmol None ناموجود BioBasic
26 فلاسک T25 بسته 10 عددي فيلتر دار Biofil کانادا 10 pcs ناموجود Jetbiofil
27 ايميدازول 100gr Acros None ناموجود Acros
28 پليت 48 خانه استريل plate ناموجود None
29 فلاسک کشت سلول 12.5cm سادهbiofil کانادا 10 pcs ناموجود Jetbiofil
30 Sodium Chloride 5KG ناموجود Acros
31 لوله فالکون 15 بسته 25عددي استريل Biofil 25 pcs ناموجود Jetbiofil
32 استريپ 0.2 (8تايي) None ناموجود چینی
33 TSH 96 Test Elisa Aminsan None ناموجود None
34 DMSO 2.5 lit Applichem None ناموجود Applichem
35 بنزن-امينسان None ناموجود ایرانی
36 سرسمپلر آبي Dnase Rnase Free None ناموجود None
37 ترازو دوکفه اي 200گرم None ناموجود None
38 لوپ - pack ناموجود BioBasic
39 Loading buffer-ايراني - None ناموجود ایرانی
40 Agarose-100gr-Acros - None ناموجود Acros
41 DNase I Solution (1 mg/mL) 0-7900 1ml ناموجود StemCell
42 Buffer K 1000 1ml ناموجود TaKaRa
43 Buffer PCR 1000 1ml ناموجود TaKaRa
44 Buffer L 1000 1ml ناموجود TaKaRa
45 Buffer Triton X100 1000 1ml ناموجود TaKaRa
46 Buffer M 1000 1ml ناموجود TaKaRa
47 Buffer H 1000 Vial ناموجود TaKaRa
48 Acetonitrile 100030 2/5L ناموجود Merck
49 Rolipram 10MG 10011132-10mg None ناموجود Cayman
50 Acc I 1001A 100U ناموجود TaKaRa
51 Zirconium chloride 10026-11-6 25 GR ناموجود Acros
52 Acc II 1002A 100 unit ناموجود None
53 Hcl Merck 2.5 lit 100317 None ناموجود Merck
54 Ethanol 100971 2.5lit ناموجود Merck
55 Ethanol 2.5lit Merck 100983 ناموجود Merck
56 BamH I 1010A 10000 U ناموجود TaKaRa
57 Ammonium persulfate [APS] 101200 1KG ناموجود Merck
58 Ban II 1012A 2000u ناموجود TaKaRa
59 Bcn I (Cau II ‘NCi1) 1019A 1,000 U ناموجود TaKaRa
60 Bgl II 1021A 2000 ناموجود TaKaRa
61 Bln I (Avr II) 1022A 400 Units ناموجود TaKaRa
62 Calcium chloride, dihydrate- 5kg-merck 102382-5KG None ناموجود Merck
63 Bsp1286 I (Sdu I) 1024A 500 Units ناموجود TaKaRa
64 4th WHO International Standard for HBV DNA for NAT 10/266 None ناموجود NIBSC
65 FBS 10270-106 500ml ناموجود Gibco
66 Dimethyl Yellow 103055-10g None ناموجود Sigma
67 Restriction Enzyme Cpo l 1035A ناموجود TaKaRa
68 EcoT14I (StyI) 1038A 3,000 Units ناموجود TaKaRa
69 Formalin-2.5Lit-Merck 104002 None ناموجود Merck
70 EcoR I 1040A 10000 U ناموجود TaKaRa
71 EcoR V 1042A 3000u ناموجود TaKaRa
72 Restriction Enzyme EcoO109 l 1043A ناموجود TaKaRa
73 Fba I (Bcl I) 1045A 500units ناموجود TaKaRa
74 Fok I 1046A 1,000 Units ناموجود TaKaRa
75 L-Arabinose 25gr 10498 Acros ناموجود BioBasic
76 Hae III 1051A 4000Units ناموجود TaKaRa
77 1,1,1,3,3,3-Hexafluoro-2-propanol 105228-5G None ناموجود Sigma
78 Hae II 1052A 1000unit ناموجود TaKaRa
79 Hap II (Hpa II, Msp I) 1053A 2,000 Units ناموجود TaKaRa
80 آمونیاک 105426 2.5lit ناموجود Merck
81 Hha I 1056A 2,000 Units ناموجود TaKaRa
82 MR-VP broth-Merck 105712-500g None ناموجود Merck
83 HincII (HindII) 1059A 1,000 Units ناموجود TaKaRa
84 Methanol Merck 2.5 lit 106007 None ناموجود Merck
85 Methanol 106008 2.5lit ناموجود Merck
86 Methanol 106018 2.5lit ناموجود Merck
87 دی کلرو متان 106050 2.5lit ناموجود Merck
88 Hind III 1060A 10000 U ناموجود TaKaRa
89 HpaI 1064A 500 Units ناموجود TaKaRa
90 Kpn I 1068A 5000u ناموجود TaKaRa
91 Mfl I (Xho II) 1070A 500 Units ناموجود TaKaRa
92 PstI 1073A 10,000 Units ناموجود TaKaRa
93 Sac I 1078A 2000 U ناموجود TaKaRa
94 Sac II 1000u 1079A 1000u ناموجود TaKaRa
95 Sal I 1080A 3,000 Units ناموجود TaKaRa
96 Sau3AI (MboI) 1082A 200 Units ناموجود TaKaRa
97 Histopaque(ficoll) 10831 100ml ناموجود Sigma
98 Sma I 1085A 2000u ناموجود TaKaRa
99 گزیلول 108681 2.5lit ناموجود Merck
100 Spe I 1086A 300 units ناموجود TaKaRa
101 Xba I 1093A 3,000 Units ناموجود TaKaRa
102 Xho I 1094A 5000U ناموجود TaKaRa
103 Xsp I (Bfa I, Mae I) 1095A 500 Units ناموجود TaKaRa
104 2پروپانول Merck 2.5 lit 109634 None ناموجود Sigma
105 Afa I (Rsa I ) 1000 units 1116A 1000U ناموجود TaKaRa
106 Eae I (Cfr I) 1123A 200 Units ناموجود TaKaRa
107 EcoO65I (BstEII, BstPI) 1135A 1,000 Units ناموجود TaKaRa
108 Sodium Pyrivate MEM 11360039 None ناموجود Invitrogen
109 Mbo II 1145A 400Units ناموجود TaKaRa
110 Msp I (Hpa II) 1150A 3,000 Units ناموجود TaKaRa
111 Water HPLC grade 115333 2.5lit ناموجود Merck
112 Skim milk powder 115363 500g ناموجود Merck
113 Nae I 1155A 500Unit ناموجود TaKaRa
114 Nco l 1160A 500Unit ناموجود TaKaRa
115 Nde I 1161A 400u ناموجود TaKaRa
116 LIFE TECHNOLOGIES LIPOFECTAMINE REAGENT 0.3ML 11668-030 None ناموجود None
117 DNA Molecular Weight Marker VII. DIG-labeled 11669940910 None ناموجود Roche
118 Not I 1166A 500 U ناموجود TaKaRa
119 2.4 dinitrophenyl hydrazin* 11706 None ناموجود Sigma
120 Taq I 1189A 2000u ناموجود TaKaRa
121 VpaK11B I (Ava II) 1196A 300 Units ناموجود TaKaRa
122 Dpn I (Mal I) 1235A 1,000 Units ناموجود TaKaRa
123 Hinf I 1238A 6000U ناموجود TaKaRa
124 Nhe I 1241A 700U ناموجود TaKaRa
125 Pvu II 1243A 4,000 Units ناموجود TaKaRa
126 SphI 1246A 600u ناموجود TaKaRa
127 pOptiVEC™-TOPO® TA Cloning® Kit 12744-017 kit ناموجود Invitrogen
128 Vindoline 13940871-10MG 10mg ناموجود Molekula
129 Vindoline 13940871-1MG None ناموجود Molekula
130 Hepatitis C virus (HCV) For nucleic acid amplification techniques (5th International standard 2015) 14/150 None ناموجود NIBSC
131 Non WHO Reference Material 4th HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques 14/290 None ناموجود NIBSC
132 Pen/Strep 20 ml Invitrogen 15140148 None ناموجود Invitrogen
133 Calsemid Invitrogen 10ml 15210-057 None ناموجود Invitrogen
134 15547 100 mg 15547 None ناموجود Cayman
135 ReadyStrip™ IPG Strips* 1632007 None ناموجود Biorad
136 ReadyStrip™ IPG Strips 1632008 None ناموجود None
137 100x BioLyte® 3/10 Ampholyte 1632094 1pack ناموجود Biorad
138 L-Isoleucine-500g- Acros 166175000 None ناموجود Acros
139 L-Isoleucine-250g- Acros 1661752500 None ناموجود Acros
140 Guanidine hydrochloride, biotech* 17577-25g None ناموجود Acros
141 Salicylic acid 17820272-1KG 1kg ناموجود Molekula
142 آلژنیک اسید 180947 100gr ناموجود Sigma
143 UREA pearls 98% 1KG 197460010 Acros ناموجود BioBasic
144 Urea-500g- Acros 19746-500g None ناموجود Acros
145 in vivo jetPEI Transfection Reagent (glucose inclus) 201-10G None ناموجود Poly Plus
146 T4 DNA Ligase 2011A 25000u ناموجود TaKaRa
147 Pro measure protein measurement solution 21011 None ناموجود Intron
148 DNA Polymerase I(E.coli) 2130A 500 Units ناموجود TaKaRa
149 Klenow Fragment 2140A 200unit ناموجود TaKaRa
150 Imidazole 21611083 500g ناموجود Molekula
151 Poly(A) Polymerase 2180A 20 Units ناموجود TaKaRa
152 Sodium deoxycholate-25g- Acros 21859-25g None ناموجود Sigma
153 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
154 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
155 Recombinant DNase I ,(RNase free) 2270A 1000u ناموجود TaKaRa
156 pvp 227545 100gr ناموجود Acros
157 Apigenin 22930039-1G ناموجود Molekula
158 SDS Acros 100g 23042 100g ناموجود Acros
159 Recombinant RNase Inhibitor 2313A 5000u ناموجود TaKaRa
160 Recombinant RNase Inhibitor 2313Q 500U ناموجود TaKaRa
161 1-Chloro-2,4-dinitrobenzene 237329 10g ناموجود Sigma
162 T7 RNA Polymerase 5000U 2540A 5000 U ناموجود TaKaRa
163 Grassofermata 1MG 26202-1mg None ناموجود Cayman
164 Exonuclease I 2650A 750 Units ناموجود TaKaRa
165 PrimeScript™ Reverse Transcriptase 2680A 10000u ناموجود TaKaRa
166 PrimeScript™ Reverse Transcriptase 2680Q 2000u ناموجود TaKaRa
167 Trichloroacetic acid 27071914-1KG 1kg ناموجود Molekula
168 Methacrylic anhydride 276685-500ML None ناموجود Sigma
169 DMEM/F-12, GlutaMAX™ supplement 31331-028 500ml ناموجود Invitrogen
170 Dextran from Leuconostoc spp.* 31390-25G None ناموجود Sigma
171 DMEM, powder, low glucose, pyruvate 31600-034 1lit ناموجود Invitrogen
172 DMEM powder 10 lit Low glucose 31600-083 10lit ناموجود Invitrogen
173 Thiometon in Shellsol 31681-250MG None ناموجود Sigma
174 Temozolomide 31724662-1G 1g ناموجود Molekula
175 RPMI 1640 Powder 1lit Invitrogen 31800-014 1lit ناموجود Invitrogen
176 Bifenazate 32504-50MG None ناموجود Sigma
177 Flonicamid 32509-25MG None ناموجود Sigma
178 pRl201-AN DNA 3264 ناموجود TaKaRa
179 T-Vector pMD20 3270 1 ug ناموجود TaKaRa
180 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-100G 100g ناموجود Molekula
181 Maltose, monohydrate 329915000-500g None ناموجود Acros
182 (+)-Usnic acid 329967-5G None ناموجود Sigma
183 Acetic Acid 33209 2.5lit ناموجود Sigma
184 Chaperone Plasmid Set 3340 1 Set ناموجود TaKaRa
185 pCold DNA Cold Shock Expression System 3360 1 Set ناموجود TaKaRa
186 Ytterbium(III) chloride hexahydrate 337927-10G None ناموجود Sigma
187 200 bp DNA ladder 3410A 50 µg ناموجود TaKaRa
188 500 bp DNA ladder 3411A 50 µg ناموجود TaKaRa
189 Wide-range DNA ladder 0.8ml TaKaRa 3415A ناموجود TaKaRa
190 Parathion-methyl 36187-100MG None ناموجود Sigma
191 Sodium tetraborate decahydrate 367207 1Kg ناموجود Carlo
192 CellAmp™ Direct RNA Prep Kit for RT-PCR (Real Time) 3732 200 Rxns ناموجود TaKaRa
193 CellAmp™ RT-PCR for Direct Prep Kit (Real Time) & Protein Analysis 3733Q 25 preps ناموجود TaKaRa
194 Laccase  from  Trametes  versicolor 38429-1G None ناموجود Sigma
195 Propidium Iodide (PI) 40016 None ناموجود Biotium
196 dATP 4026 100 umol ناموجود TaKaRa
197 dGTP 4027 100 umol ناموجود TaKaRa
198 dCTP 4028 100 umol ناموجود TaKaRa
199 dTTP 4029 100 umol ناموجود TaKaRa
200 dNTP Mixture 180 ul 4030 180ul ناموجود TaKaRa
201 dNTP mixture 4030 1.28 ml ناموجود TaKaRa
202 Gel Red 41003 0.5ml ناموجود Biotium
203 2-Hydroxy-4?-(2-hydroxyethoxy)-2-methylpropiophenone 410896-10G None ناموجود Sigma
204 Nutrient Broth- Applichem 413793.1210-500g None ناموجود Acros
205 Paraformaldehyde 416782500 100gr ناموجود Acros
206 (+)-cat_numberechin 43412 10MG ناموجود Sigma
207 Thulium(III) chloride 439649-1G None ناموجود Sigma
208 Dinocap 45452-100MG None ناموجود Sigma
209 Carbazole 46100-250MG-R None ناموجود Sigma
210 Aspartame 47135 500mg ناموجود BioBasic
211 ProClin™ 300 48914-U None ناموجود Sigma
212 Curcumin 49256996-1g None ناموجود Molekula
213 Curcumin 49256996-25G 25g ناموجود Molekula
214 Curcumin 49256996-5g 5g ناموجود Molekula
215 لوله فالکون 15 استريل RNase & DNase Free بسته 50عددي 50015 None ناموجود SPL
216 RPMI 1640 Powder 1 lit Invitrogen 51800-019 1lit ناموجود Invitrogen
217 RPMI 1640 Powder 10lit Invitrogen 51800-035 10lit ناموجود Invitrogen
218 Resveratrol 51852282-1G 1g ناموجود Molekula
219 Gold(III)  chloride  trihydrate 520918-1G None ناموجود Sigma
220 Tannic acid 52612564-1KG 1Kg ناموجود Molekula
221 DNA Ligation Kit, Mighty Mix 6023 100 Rxns ناموجود TaKaRa
222 DNA Ligation Kit Mighty Mix (20 react) 6023Q ناموجود TaKaRa
223 cDNA synthesis kit: PrimeScript First Strand cDNA Synthesis Kit 6110A 50 Rxns ناموجود TaKaRa
224 3'-Full RACE Core Set 6121 20 react ناموجود TaKaRa
225 3'-Full RACE Core Set 6122 10 react ناموجود TaKaRa
226 PrimeScript II 1st strand cDNA synthesis kit 6210A Kit ناموجود TaKaRa
227 Lenti-X™ qRT-PCR Titration Kit 200 Rnx Clontech 631235 1kit ناموجود TaKaRa
228 Xfect Transfection Reagent 631316 None ناموجود TaKaRa
229 N-Ethylmaleimide 63480 None ناموجود Sigma
230 Real Time qPCR Master Mix - Terra qPCR Direct SYBR Premix 638319 ناموجود TaKaRa
231 1-Ethyl-3-methylimidazolium L-(+)-lactate 669512 5G ناموجود Sigma
232 فلاسک کشت سلول 25cm فيلتردار استريل بسته5 عددي 70025 None ناموجود SPL
233 فلاسک کشت سلول 75cm فيلتردار استريل بسته5 عددي 70075 None ناموجود SPL
234 Skim Milk Powder 70166-500G 500G ناموجود Sigma
235 HRV 3C Protease 500U 7360 None ناموجود TaKaRa
236 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-10G ناموجود Molekula
237 Acrylamide 800830 1kg ناموجود Merck
238 4-CHLOROPHENOL 802254 100gr ناموجود Merck
239 2.7-Dichlorodihydrofluorescein diacetate 85155-50MG None ناموجود Cayman
240 Quercetin 86015335-1G 1g ناموجود Molekula
241 Catharanthine 89985253-10MG 10mg ناموجود Molekula
242 Catharanthine 89985253-1MG None ناموجود Molekula
243 Hydroxyapatite 900193-50G None ناموجود Sigma
244 RNase-Free Water 9012 1ml ناموجود TaKaRa
245 RNase -Free Water-1ML 9012-1ML 1ML ناموجود TaKaRa
246 IPTG 9030 5gr ناموجود TaKaRa
247 X-Gal 9031 1gr ناموجود TaKaRa
248 DNA OFF 9036 500ml ناموجود TaKaRa
249 RNase - OFF 500 ml 9037 500ml ناموجود TaKaRa
250 E. coli HB101 Competent Cells 9051 Set ناموجود TaKaRa
251 GC Buffer I 9154 1.25ml ناموجود TaKaRa
252 Loading buffer 10 X 9157 vials ناموجود TaKaRa
253 High Reverse Transcriptase (RNase H-, 10000 U) 9K-005-0005-10000U None ناموجود BioBasic
254 Alcian blue 8GX A0298 5gr ناموجود BioBasic
255 Potassium hydroxide A0566 1kg ناموجود Applichem
256 Albumin EIA and RIA grad A0850 500g ناموجود Applichem
257 Albumin A0850,0500 None ناموجود Applichem
258 Agar Bacteriology grade- Applichem A0949-500g None ناموجود Applichem
259 8-Anilino-1-naphthalenesulfonic  acid A1028-5G None ناموجود Sigma
260 Amyloid beta Protein Fragment 1-40 A1075-.1MG None ناموجود Sigma
261 Calcium Chloride dried, powdered pure A1428-0500 ناموجود Applichem
262 Streptavidin ultrapure A1495 1mg ناموجود None
263 Streptavidin ultrapure A1495 1gr ناموجود Applichem
264 Peptone from meat- Applichem A1835-500g None ناموجود Applichem
265 Acetyl coenzyme A sodium salt A2056 1MG ناموجود Sigma
266 D(+)-Xylose- Applichem A2241-100g None ناموجود Sigma
267 5-Azacytidine A2385 100MG ناموجود None
268 Amphotericin B solution A2942 100ml ناموجود Sigma
269 Peroxidase HRP A3615 None ناموجود Applichem
270 LB-Medium- Applichem A6666-500g None ناموجود Applichem
271 Acridine orange hemi salt A742007 10G ناموجود BioBasic
272 Acridine orange hemi salt A742007-5G None ناموجود BioBasic
273 Anti-Human IgG−Peroxidase antibody produced in rabbit A8792 2ml ناموجود Sigma
274 Amberlite™ IRN-77, ion exchange resin, Nuclear grade, Alfa Aesar™ AA1682136 - Alfa Aesar™ None ناموجود AlfaAesar
275 Acetylcholine chloride AB0002 25gr ناموجود BioBasic
276 Agarose M AB0013 250gr ناموجود BioBasic
277 Agarose B, low EEO AB0014 250gr ناموجود BioBasic
278 Agarose, Low melting gel AB0015 10gr ناموجود BioBasic
279 Agarose, Low melting gel.SIZE.25G AB0015-25G 25G ناموجود BioBasic
280 L-Asparagine monohydrate AB0017 100g ناموجود BioBasic
281 L-Ascorbic acid ( Vitamin C) AB0021 100G ناموجود BioBasic
282 Ampicillin, sodium salt USP AB0028 25gr ناموجود BioBasic
283 Ampicillin,sodium salt USP 5gr Ab0028-5g None ناموجود BioBasic
284 Nitrilotriacetic acid AB0055 100gr ناموجود BioBasic
285 Ampicillin, trihydrate AB0064 25G ناموجود BioBasic
286 Ammonium persulfate [APS] AB0072 25G ناموجود BioBasic
287 L-Arginine free base AB0205-10G 10g ناموجود BioBasic
288 L-Arginine free base AB0205-25G 25g ناموجود BioBasic
289 L-Arginine AB0205.SIZE.500G None ناموجود BioBasic
290 Normal Goat Serum Ab156046 None ناموجود َAbcam
291  N-Acetyl-L-Cysteine AB6697 25gr ناموجود BioBasic
292 Goat  Anti-Rabbit  IgG  H&L  (HRP) AB97069 ناموجود Sigma
293 ABTS , di ammonium salt AD0002 1gr ناموجود BioBasic
294 ACES AD0004 500gr ناموجود BioBasic
295 ACES AD0004-500G 500G ناموجود BioBasic
296 Adenosine AD0016 25G ناموجود BioBasic
297 Adenosine AD0016 5gr ناموجود BioBasic
298 L-Alanine .SIZE.25G AD0022-25G 25g ناموجود BioBasic
299 Albumin, heat shock isolation pH 7.0 AD0023 25gr ناموجود BioBasic
300 Amido black 10B AD0027 5gr ناموجود BioBasic
301 Amphotericin B AD0030P 5g ناموجود BioBasic
302 Avidin AD0068 5MG ناموجود BioBasic
303 Alizarin red S AD0144 25gr ناموجود BioBasic
304 Mupid One Submarine AD160 دستگاه ناموجود TaKaRa
305 Ammonium chloride ADB0034 500gr ناموجود BioBasic
306 Ammonium sulfate ADB0060 500gr ناموجود BioBasic
307 ترازو دقیق دیجیتالی (دقت یک صدم، ظرفیت 4000 گرم AGZ4000C دستگاه ناموجود None
308 TACCAAGAGAACTACATATCCGATGACCTTCCGTGGGGCCTAGTAGTTGCGGGACTACTAGACACTGTATGA apte zia-72bp None ناموجود BioBasic
309 Albumin, Protease Free AR2449 50gr ناموجود BioBasic
310 Rapid animal G-DNA AT4780 10prep ناموجود BioBasic
311 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 320 گرم) ATA320 دستگاه ناموجود None
312 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 520 گرم) ATA520 دستگاه ناموجود None
313 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 320 گرم) ATZ320 دستگاه ناموجود None
314 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 520 گرم) ATZ520 دستگاه ناموجود None
315 Alkaline phosphatase Power AP AZ140A 1mg ناموجود BioBasic
316 Taq DNA Polymerase, 5U/UL B0089 200u ناموجود BioBasic
317 Taq DNA Polymerase, 5U/UL B0089(D0089) 1000u ناموجود BioBasic
318 TAQ DNA POLYMERASE, 5U/UL.SIZE.500U B0089(D0089)-500U None ناموجود BioBasic
319 T4 DNA LIGASE, 5U/UL.SIZE.200U B1125-200U None ناموجود BioBasic
320 bisBenzimide H 33258 B2883-25MG None ناموجود Sigma
321 Boric acid BB0044 500gr ناموجود BioBasic
322 D-Biotin BB0078 1gr ناموجود BioBasic
323 D-Biotin .SIZE.5G BB0078-5gr 5G ناموجود BioBasic
324 X-Gal BB0083 1gr ناموجود BioBasic
325 X-GLUC (X-GlcA) BB0085 25MG ناموجود BioBasic
326 Bacitracin zinc BB0113 25G ناموجود BioBasic
327 Bile salt BB0225-25G 25g ناموجود BioBasic
328 RNase H, 10U/UL BEN0202 500u ناموجود BioBasic
329 RNase I, 10U/UL BEN0601 1 Ku ناموجود BioBasic
330 10-175kDa Wide Range Protein Molecular Weight Marker, Prestained11 band: 10, 15, 20, 30, 40, 50, 60, 70, 95, 120, 175kDa BG00363 500ul ناموجود BioBasic
331 10-240kDa Wide Range 3 Color Prestained Protein Ladder BG00364 500UL ناموجود BioBasic
332 Mini gene synthesis 151bp with subcloning pUC57 BHV1 None ناموجود BioBasic
333 DMSO cell culture grade-7.5ml BI-1407 None ناموجود ایرانی
334 Low Range Protein Molecular Weight Marker BM201 30ul ناموجود BioBasic
335 Protein Marker, Mid Range, ready to use BM523 200ul (20 loadings) ناموجود BioBasic
336 14.4-98kDa Mid Range Protein Molecular Weight Marker BM524 200ul ناموجود BioBasic
337 0.2ML PCR TUBE, FLAT CAP BP541-S100 0.2ML ناموجود BioBasic
338 تیوب 5/0 میلی لیتر مخصوص PCRبدون رنگ با درب تخت دارای بسته بندی 1000تایی Rnase/DNase Free BP602-S100 بسته ناموجود BioBasic
339 تیوب 5/0 میلی لیتر مخصوص PCRبدون رنگ با درب تخت دارای بسته بندی 100تایی Rnase/DNase Free BP602-S100-1pak 100pcs ناموجود BioBasic
340 Mini gene synthesis 204bp with subcloning pUC57 BPI3 None ناموجود BioBasic
341 Mini gene synthesis 252bp with subcloning pUC57 BRSV None ناموجود BioBasic
342 EZ-10 Spin Column DNA Gel Extraction Kit BS354 100 preps ناموجود BioBasic
343 EZ-10 Spin Column PCR names Purificat_numberion Kit BS363 50preps ناموجود BioBasic
344 EZ-10 Cleanup Minipreps Kit BS367 50 PREPS ناموجود BioBasic
345 Mammalian Protease Inhibitor Cocktail, 100x Strength Solution BS386 1ml ناموجود BioBasic
346 EZ-RNA Reagents (Trizol) BS409A 25ML ناموجود BioBasic
347 EZ-RNA Reagents 10ml BS409A-10ML None ناموجود BioBasic
348 EZ-RNA Reagents (Trizol) BS410A 100ml ناموجود BioBasic
349 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS414 100 preps ناموجود BioBasic
350 EZ-10Spin Column Bacterial DNA Mini Preps Kit 50pr BS423-50 preps 50 preps ناموجود BioBasic
351 PCR Product Cloning Kit BS435-20 preps None ناموجود BioBasic
352 PCR Product Cloning Kit BS436-100PREPS None ناموجود BioBasic
353 Fast DNA Ligation Kit(5u/ul.T4) BS512-50 Rxn None ناموجود BioBasic
354 EZ-10 Spin Column Total RNA Mini-Preps Super Kit BS584 100preps ناموجود BioBasic
355 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS614 250 preps ناموجود BioBasic
356 EZ-10 Spin Column DNA Gel Extraction Kit BS654 250 preps ناموجود BioBasic
357 EZ-10 Spin Column Animal Total RNA Mini-Preps Kit BS82312 50 preps ناموجود BioBasic
358 One-Tube Tissue DNA Extraction Kit BS8401 100 preps ناموجود BioBasic
359 One-Tube Clinical Sample DNA Extraction Kit.SIZE.100 Preps BS8403-100prep None ناموجود BioBasic
360 One-Tube Bacteria DNA Isolation Kit BS8413 100 PREPS ناموجود BioBasic
361 RNase-Free DNase Set BS88253-50 preps None ناموجود BioBasic
362 EZ-10 Spin Column Fungal RNA Mini-Preps Kit BS91915 50 PREPS ناموجود BioBasic
363 14.4-116kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0431 2x1ml ناموجود BioBasic
364 14.4-116kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0431 1ml ناموجود BioBasic
365 20-120kDa Mid Range Protein Molecular Weight Marker, Prestained BSM0441 250UL ناموجود BioBasic
366 20-120kDa Mid Range Protein Molecular Weight Marker, Prestained BSM0441-250UL ناموجود BioBasic
367 10-200kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0661 2x250ul ناموجود BioBasic
368 10-200kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0661-250ul 250ul ناموجود BioBasic
369 10-170kDa Wide Range Protein Molecular Weight Marker, Prestained BSM0671 2x250ul ناموجود BioBasic
370 10-170kDa Wide Range Protein Molecular Weight Marker, Prestained BSM0671-250ul 250ul ناموجود BioBasic
371 Total Protein Extraction Kit BSP003 50preps ناموجود BioBasic
372 0.1-10ul Micro Tips, Short,1000/Pack,Sterile BT215 1000Pack ناموجود BioBasic
373 سرسمپلرکریستالی کوتاه (10-0.1 میکرو لیتر) استریل Rnase/DNase Free بسته هزار عددی BT215-S بسته هزار عددی ناموجود BioBasic
374 سر سمپلر آبی (1000-100میکرولیتر) استریل بدون Rnase/DNase Free رنگ بسته هزار عددی BT222-NS بسته هزار عددی ناموجود BioBasic
375 سر سمپلر زرد (200 میکرو لیتر) مدرج استریل بدون رنگ بسته هزار عددی Rnase/DNase Free BT224-NS بسته ناموجود BioBasic
376 رک سر سمپلر زرد (200 میکرو لیتر) مدرج استریل Rnase/DNase Free بدون رنگ BT224-RS Rack ناموجود BioBasic
377 سرسمپلر 300میکرولیتر، استریل  Rnase/DNase Free BT330-NS 1000 pcs ناموجود BioBasic
378 Rapid Blood RNA Isolation Kit BT4182 10preps ناموجود BioBasic
379 Rapid Blood DNA Extraction Kit BT4782 50preps ناموجود BioBasic
380 تیوب 1/5 میلی لیتر بدون رنگ دارای بسته بندی 1000تایی و استریل Rnase/DNase Free BT620-NS بسته ناموجود BioBasic
381 1.5ML Tube, Natural, Sterile, /Bag 100 BT620-NS-100Pak None ناموجود BioBasic
382 فالکون 15 BT888-SN بسته 100 تایی ناموجود BioBasic
383 15ML Centrifuge Tube, Screw Cap, Red, Sterile, 100/Bag BT888-SR SR ناموجود BioBasic
384 15ML Centrifuge Tube, Screw Cap, Yellow, Sterile, 100/Bag BT888-YS 100pcs ناموجود BioBasic
385 ترازو دقیق دیجیتالی (دقت یک صدم، ظرفیت 2100 گرم BTA2100D دستگاه ناموجود None
386 ترازو دقیق دیجیتالی (دقت یک هزارم، ظرفیت 210 گرم BTA210D دستگاه ناموجود None
387 Mini gene synthesis 185bp with subcloning pUC57 BVDV1 None ناموجود BioBasic
388 Mini gene synthesis 193bp with subcloning pUC57 BVDV2 None ناموجود BioBasic
389 Caffeine C0150 100gr ناموجود BioBasic
390 (−)-cat_numberechin C0567 5MG ناموجود Sigma
391 (±)-cat_numberechin hydrate C1788 500MG ناموجود Sigma
392 Cesium chloride         C3032 25gr ناموجود BioBasic
393 Acetylcholinesterase from Electrophorus electricus (electric eel) C3389 2KU ناموجود Sigma
394 Acetylcholinesterase from Electrophorus electricus (electric C3389-500U ناموجود None
395 Water C8801 500ml ناموجود BioBasic
396 Cyanogen bromide-activated-Sepharose® 4B 1g Sigma C9142 None ناموجود Sigma
397 Calcium nitrate tetrahydrate, extra pure Ca(NO3)2·4H2O CA0230 1kg ناموجود Scharlau
398 Coomassie brilliant blue R-250    CB0037 25gr ناموجود BioBasic
399 Citric acid CB0055 1Kg ناموجود BioBasic
400 L-Cysteine CB0088-500g None ناموجود BioBasic
401 CTAB CB0108 100g ناموجود BioBasic
402 L-Cysteine CB0132-500g None ناموجود BioBasic
403 CELLBANKER 1plus CB022  20ml ناموجود TaKaRa
404 Calcium phosphate, tribasic CB0263 250gr ناموجود BioBasic
405 CELLBANKER 2 CB032  20ml ناموجود TaKaRa
406 Curcumin CB0346 5gr ناموجود BioBasic
407 Cytochrome C CB0354-100MG 100G ناموجود BioBasic
408 STEM-CELLBANKER CB042  20ml ناموجود TaKaRa
409 STEM-CELLBANKER CB044S  4ml ناموجود TaKaRa
410 STEM-CELLBANKER GMP grade CB047 4*20 ml ناموجود TaKaRa
411 Chlorocholine chloride CB0736 5G ناموجود BioBasic
412 Cresol red, free acid CD0037B 5gr ناموجود BioBasic
413 Calcium chloride, dihydrate CD0050-2.5kg 2.5kg ناموجود BioBasic
414 Calcium chloride, dihydrate CD0050-500G 500gr ناموجود BioBasic
415 Cholesterol CD0122 50gr ناموجود BioBasic
416 Cytosine CD0138 10gr ناموجود BioBasic
417 Copper (II) sulfate pentahydrate CDB0063-400g ناموجود BioBasic
418 Carbenicillin disodium CDJ469.SIZE.5G 5G ناموجود BioBasic
419 CASEIN CN5204 500gr ناموجود BioBasic
420 تیوب ml50با درب بدون رنگ مخصوص سرعت بالا، استریل/بسته 25تایی  Rnase/DNase Free CT790-SN 25pcs ناموجود BioBasic
421 Agarose A D0012-250gr 250gr ناموجود BioBasic
422 Albumin,pH 5.1+0. D0024 50gr ناموجود BioBasic
423 Albumin,pH 5.1+0.2 10gr D0024-10G 10G ناموجود BioBasic
424 Albumin,pH 5.1+0.2 25gr D0024-25G 25G ناموجود BioBasic
425 Albumin, pH 5.1+0.2 5gr D0024-5G 5G ناموجود BioBasic
426 2'-Deoxythymidine-5'-triphosphate 100mM solution[dTTP], sodium salt D0046T 0-5ml ناموجود BioBasic
427 TSG DNA POLYMERASE, 5U/UL.SIZE. 200 u D0081-200u None ناموجود BioBasic
428 Dialysis tubing cellulose membrane23mm غشاء دیالیز با قطر 23mm (Molecular weight cut-off : 12400Da) D0405 1meter ناموجود Sigma
429 Dialysis tubing cellulose membrane32mm غشاء دیالیز با قطر 32mm (Molecular weight cut-off : 12400Da) D0530 1meter ناموجود Sigma
430 1,4-Diaminobutane D13208 100gr ناموجود Sigma
431 Diphenyl phosphite D210803 100gr ناموجود Sigma
432 Dimethyl sulfoxide (DMSO) Cell Culture Grade D2650-10ML 10ml ناموجود Sigma
433 Dansyl chloride D705183 1G ناموجود BioBasic
434 Dialysis tubing cellulose membrane10mm غشاء دیالیز با قطر 10mm (Molecular weight cut-off : 14KDa) D9277 1meter ناموجود None
435 Dialysis tubing cellulose membrane43mm غشاء دیالیز با قطر 43mm (Molecular weight cut-off : 14KDa) D9527 1meter ناموجود Sigma
436 DAB, tetra hydrochloride DB0140 5gr ناموجود BioBasic
437 DAB, tetra hydrochloride DB0140 25gr ناموجود BioBasic
438 Dextran sulfate DB0160 10g ناموجود BioBasic
439 Sodium chloride DB0483 2.5kg ناموجود BioBasic
440 Sodium azide DB0613 100gr ناموجود BioBasic
441 Doxycycline, hydrochloride DB0889 25gr ناموجود BioBasic
442 Deoxycholic acid, sodium salt DD0150 50G ناموجود BioBasic
443 DEPC Water DD1005 500ml ناموجود BioBasic
444 DNAfectamine DNAF001-0.1ML None ناموجود BioBasic
445 Eco-Stain . ready to use DT81413-1 ML 1ML ناموجود BioBasic
446 Eco Green-DNA Dye ,ready to use 1.5ml DT81414-1.5ml 1.5ml ناموجود BioBasic
447 Eco-Red-DNA Dye . Ready to use DT81415-1 ML 1ML ناموجود BioBasic
448 Benzonase® Nuclease E1014 25ku ناموجود Sigma
449 Benzonase® Nuclease E1014 5ku ناموجود Sigma
450 Elastase from human leukocytes E8140-1UN None ناموجود Sigma
451 EDTA , disodium salt , dihydrate EB0185 500gr ناموجود BioBasic
452 EDTA, disodium salt, dihydrateSIZE.100G EB0185-100G 100g ناموجود BioBasic
453 Ethidium bromide (EB; EtBr) EB0195 1gr ناموجود BioBasic
454 EDAC, hydrochloride EB0433 25g ناموجود BioBasic
455 EDAC, hydrochloride.SIZE.5G EB0433-5G 5g ناموجود BioBasic
456 Ethyl acetate Reagent EC4600 1lit ناموجود Sigma
457 Ethylene glycol ED0199 250ml ناموجود BioBasic
458 Alu I ER0011 600U ناموجود Thermo
459 Thermo Scientific™ PstI (10 U/µL) ER0611 None ناموجود Thermo
460 MnlI ER1071 None ناموجود Thermo
461 Freund’s Adjuvant, InComplete F5506 10ml ناموجود BioBasic
462 Fluorescein  diacetate F7378-10G None ناموجود None
463 Formamide deionized FB0211-500ml None ناموجود BioBasic
464 Fast Green FCF FB0452 5gr ناموجود BioBasic
465 Iron(II) sulfate . heptahydrate FB0461-500g None ناموجود BioBasic
466 کرایوتیوب 1.8 استریل بسته20عددی jetbiofil کانادا FCT312020 None ناموجود Jetbiofil
467 Iron (III) sulfate, hydrate FD0208 250gr ناموجود BioBasic
468 Thermo Scientific™ FastDigest™ Bsp1407I FD0933 None ناموجود Thermo
469 Formamide FDB0212 500ml ناموجود BioBasic
470 Formononetin 100 mg FF09317-100mg None ناموجود Carbosynth
471 Sorafenib tosylate 500 mg FS10808 None ناموجود Carbosynth
472 رک سرسمپلرفیلتردار10-1/0 میکرو لیتراستریل رک 96 عددی  Rnase/DNase Free FT215-RNS رک 96 عددی ناموجود BioBasic
473 سرسمپلر فیلتردار شفاف –سایز 1000-100میکرولیتر بسته 1000 عددی FT222 1000pcs ناموجود BioBasic
474 سرسمپلرفیلتردار100-10  میکرو لیتر بسته 1000 عددی FT224 1000pcs ناموجود BioBasic
475 10-100UL Filter Tip, Natural, Sterile, 96/Rack FT224-RNS رک 96 عددی ناموجود BioBasic
476 0.5-10UL FILTER TIP, NATURAL,1000/PACK FT225 ناموجود BioBasic
477 Gluglutaraldehyde G0875 25ml ناموجود BioBasic
478 Agar C G1253 500G ناموجود BioBasic
479 Peptone B SOY Protein G214 500G ناموجود BioBasic
480 Peptone B SOY Protein G214-100G 100G ناموجود BioBasic
481 Peptone F Lactalbumin Hydrolysate G256 500G ناموجود BioBasic
482 Guanidine Oxidized* G4375-1g None ناموجود Sigma
483 Gelatin from bovine skin G9382-1KG None ناموجود Sigma
484 Gelatin G9764 100gr ناموجود BioBasic
485 Gelatin.SIZE.50G G9764-50G 50g ناموجود BioBasic
486 D(+)Galactose GB0215 25gr ناموجود BioBasic
487 D-Glucose, monohydrate GB0218 500gr ناموجود BioBasic
488 D-Glucose, anhydrous Gb0219 1KG ناموجود BioBasic
489 Glutathione oxidized GB0228 1g ناموجود BioBasic
490 Glutathione reduced GB0229 1gr ناموجود BioBasic
491 Glutathione reduced GB0229 5gr ناموجود BioBasic
492 Glycerol GB0232 500ml ناموجود BioBasic
493 Glycerol SIZE.400ML GB0232-400ml None ناموجود BioBasic
494 glycine GB0235 2.5K ناموجود BioBasic
495 Guanidine hydrochloride, biotech GB0242 500G ناموجود BioBasic
496 Guanidine hydrochloride, biotech GB0242 100gr ناموجود BioBasic
497 Guanidine hydrochloride, reagent GB0243 500G ناموجود BioBasic
498 Guanidine thiocyanate, biotech GB0244 250G ناموجود BioBasic
499 Guanidine thiocyanate, biotech GB0244 1KG ناموجود BioBasic
500 Glycogen GB0301 1gr ناموجود BioBasic
501 Guanine GD0246 25gr ناموجود BioBasic
502 G 418 sulfate GDJ958 1gr ناموجود BioBasic
503 Guanidine thiocyanate, ultra pure.SIZE.250G GDR0244 None ناموجود None
504 Guanidine thiocyanate, ultra pure.SIZE.1KG GDR0244 1KG ناموجود BioBasic
505 Amersham™ Hybond® P Western blotting membranes, PVDF GE10600021 1ea ناموجود Sigma
506 DEAE Sepharose® Fast Flow GE17-0709-10 25ml ناموجود GE Health Care
507 Percoll® PLUS GE17-5445-02 None ناموجود GE Health Care
508 Gene synthesis 336bp Gene Synthesis AMINO073 None ناموجود BioBasic
509 ECL™ Western Blotting Detection GERPN2209 Kit ناموجود None
510 Low MW DNA Marker A ready touse25,50,75,100,150,200,300,400,500bp GM303 20 loading ناموجود BioBasic
511 25-500bp Low Range DNA Marker A, Ready-to-use GM303-20 loading None ناموجود BioBasic
512 DNA Marker B, Ready-to-use 100-600bp Low Range DNA Marker B, Ready-to-Use 6 DNA fragments: 100, 200, 300, 400, 500, 600bp GM331 50 Loading ناموجود BioBasic
513 دسته هاون خردکننده بافت، مخروطی شکل GR111 100 loading ناموجود BioBasic
514 Adenovirus Fiber monomer and trimer antibody [4D2] GTX23233 None ناموجود Genetex
515 AR monoclonal antibody (M04), clone 3D10 H00000367-M04-100ug None ناموجود Abnova
516 CASP3 (Human) Recombinant Protein (P01) H00000836 P01-10ug ناموجود Abnova
517 IFNB1 purified MaxPab rabbit polyclonal antibody (D01P) H00003456 D01P-100ug ناموجود Abnova
518 TRAF6 monoclonal antibody (M02), clone 1B2 H00007189 M02-50ug ناموجود Abnova
519 IL1R2 monoclonal antibody (M01), clone 1G12 H00007850 M01-100ug ناموجود Abnova
520 Hanks , Balanced Salts,Powder H2387 1lit ناموجود Sigma
521 6-Hydroxydopamine hydrochloride H4381 100mg ناموجود Sigma
522 Oligo synthesis HAP Purification OD2 H510001-0002 None ناموجود BioBasic
523 HEPES free acid SiZE.25gr HB0264 ناموجود BioBasic
524 HEPES, sodium salt HB0265 1KG ناموجود BioBasic
525 Histamine dihydrochloride HB0501 5gr ناموجود BioBasic
526 N-Hydroxysuccinimide HB0526 25G ناموجود BioBasic
527 N-Hydroxysuccinimide HB0526-10g 10g ناموجود BioBasic
528 N-Hydroxysuccinimide HB0526-20g ناموجود BioBasic
529 HCL -500ml-Acros HCL -500ml-Acros 500ml ناموجود BioBasic
530 8-Hydroxyquinoline (8-Quinolinol) HD0274 100G ناموجود BioBasic
531 L-Histidine, monohydrochloride, HE806-10G 10g ناموجود BioBasic
532 5X All-In-One RT MasterMix (50ul) HRT025-10.25RXNS None ناموجود BioBasic
533 5X All-In-One RT MasterMix (200ul) HRT100-10.100RXNS None ناموجود BioBasic
534 5X All-In-One RT MasterMix (400ul) HRT200-10.SIZE.200 None ناموجود BioBasic
535 4- Isothiocyanatophenyl α-D- Mannopyranoside I905135 100mg ناموجود TRC
536 Ice Pack IB003 Pack ناموجود BioBasic
537 IPTG IB0168 25gr ناموجود BioBasic
538 IPTG IB0168-100G 100g ناموجود BioBasic
539 Imidazole IB0277 100g ناموجود BioBasic
540 Imidazole IB0277 500g ناموجود BioBasic
541 myo-inositol IB0536.SIZE.500G None ناموجود BioBasic
542 Iodoacetamide IB0539 5gr ناموجود BioBasic
543 ICE PACK ICE None ناموجود BioBasic
544 Gene synthesis 1683bp AMINO070 J508021-0001 None ناموجود BioBasic
545 Subcloning Service pCDH-CMV J508022-0001 None ناموجود BioBasic
546 Kanamycin sulfate -1gr K4000 None ناموجود Sigma
547 Keratinase K4519-500UN None ناموجود None
548 TNF (Human) ELISA Kit KA0191 1Kit ناموجود Abnova
549 Il6 (Rat) ELISA Kit KA0278 kit ناموجود Abnova
550 Tnf (Rat) ELISA Kit KA0280 1 Kit ناموجود Abnova
551 Bdnf (Mouse) ELISA Kit KA0331 1 Kit ناموجود Abnova
552 MMP2 (Human) ELISA Kit KA0391 kit ناموجود Abnova
553 Annexin V-FITC Apoptosis Kit KA0714 1 Kit ناموجود Abnova
554 Annexin V-FITC Apoptosis Kit (Premium) using SYTXO green dye and annexin V-FITC for apoptosis detection. KA0715 1 Kit ناموجود Abnova
555 Caspase-1 Assay Kit (Colorimetric) KA0727 None ناموجود Abnova
556 Caspase-3 Assay Kit (Colorimetric) KA0740 kit ناموجود Abnova
557 LDH-Cytotoxicity Assay Kit KA0785 1Kit ناموجود Abnova
558 Ammonia Assay Kit KA0810 1Kit ناموجود Abnova
559 Glucose Assay Kit KA0831 1Kit ناموجود Abnova
560 Thioredoxin Reductase Assay Kit KA0883 None ناموجود Abnova
561 Senescence Detection Kit KA0899 None ناموجود Abnova
562 JC-1 Mitochondrial Membrane Potential Assay Kit KA1324 None ناموجود Abnova
563 MTT Cell Viability Assay Kit KA1606 Kit ناموجود Abnova
564 ATPase/GTPase Assay Kit KA1610 1Kit ناموجود Abnova
565 CXCL16 (Human) ELISA Kit KA2186 None ناموجود Abnova
566 SERPINE1 (Human) ELISA Kit KA3102 None ناموجود Abnova
567 Caspase Substrate Assay Kit (Colorimetric) KA3694 Kit ناموجود Abnova
568 PLAT (Human) ELISA Kit KA3834 None ناموجود Abnova
569 Arg8-Vasopressin ELISA Kit KA4582 None ناموجود Abnova
570 IL8 (Human) ELISA Kit KA4806 None ناموجود Abnova
571 a-2-Ketoglutaric acid, disodium salt, dihydrate KD0289 100gr ناموجود BioBasic
572 Lipopolysaccharides from Escherichia coli O111:B4 L2630-10MG None ناموجود Sigma
573 Luteinizing Hormone from sheep pituitary L5269 Vial ناموجود Sigma
574 Lactoperoxidase from Bovine Milk L8257 25mg ناموجود Sigma
575 L-Lysine, monohydrochloride LB0171 250gr ناموجود BioBasic
576 Lithium dodecyl sulfate LB0569 25G ناموجود BioBasic
577 L-Leucine LB0922 500G ناموجود BioBasic
578 L-Leucine LB0922 100gr ناموجود BioBasic
579 Light green SF, Yellowish LD0007 25g ناموجود BioBasic
580 Lithium chloride, anhydrous LDB0307 250gr ناموجود BioBasic
581 Lysozyme LDB0308 100G ناموجود BioBasic
582 Lithium nitrate-Acros-250G Lithium nitrate-Acro 250G ناموجود BioBasic
583 500-10000bp DNA Marker, Ready-to-use M101R-1 SIZE.100 loading None ناموجود BioBasic
584 100 bp-10 Kb Wide Range DNA Logical Marker, Ready to use16 D M103R-1 100 LOADING ناموجود BioBasic
585 DNA Marker Wide Range,Ready to use (100bp-10Kb) M103R-1 100 loading ناموجود BioBasic
586 100bp-1.5kb DNA Ladder Marker J4 ready to use 100,200,300,400,500,600,700,800,900,1000,1500bp M107R-1 100 Loading ناموجود BioBasic
587 100-1500bp DNA Marker, Ready-to-use M107R-1.Size.100 loadings None ناموجود BioBasic
588 MTT M2128 1gr ناموجود Sigma
589 Myricetin 500MG M2131-500MG None ناموجود Sigma
590 erpes simplex virus type 1/2 gD monoclonal antibody, clone HA025 MAB13574-100ug None ناموجود Abnova
591 Herpes simplex virus type 1 ICP0 monoclonal antibody, clone H1A027 MAB13583-100ug None ناموجود Abnova
592 Herpes simplex virus type 1 ICP4 monoclonal antibody, clone H1A021 MAB13584-100ug None ناموجود Abnova
593 CEA monoclonal antibody MAB1393-1mg None ناموجود Abnova
594 HSP70/HSP90AA1 monoclonal antibody,clone BB70 MAB2196 100ug ناموجود Abnova
595 MYD88 monoclonal antibody, clone 2E9C2 MAB2745 100ug ناموجود Abnova
596 Clostridium tetani Tetanus toxin monoclonal antibody, clone TetH6 MAB2884-200ug None ناموجود Abnova
597 Clostridium botulinum Toxin A monoclonal antibody, clone B36 MAB4095 1mL ناموجود Abnova
598 Clostridium botulinum Toxin B monoclonal antibody, clone B36 MAB4096 1mL ناموجود Abnova
599 IL1R1 monoclonal antibody, clone BDI204 MAB4240 200ug ناموجود Abnova
600 Escherichia coli O157:H7 monoclonal antibody MAB5413 100ug ناموجود Abnova
601 5-Methylcytosine monoclonal antibody, clone 5MC-CD MAB6766 100ug ناموجود Abnova
602 MOPSO, free acid MB0234 25gr ناموجود BioBasic
603 Magnesium sulfate, heptahydrate, ACS MB0329 500G ناموجود BioBasic
604 D-Mannitol MB0335 500G ناموجود BioBasic
605 b-Mercaptoethanol MB0338 100ml ناموجود BioBasic
606 MES, free acid, monohydrate MB0341-100G 100g ناموجود BioBasic
607 MES, free acid, monohydrate MB0341-500G 500g ناموجود BioBasic
608 Methylene blue, chloride, trihydrate MB0342 250G ناموجود BioBasic
609 L-Methionine MB0346-10G 10g ناموجود BioBasic
610 L-Methionine MB0346-5G 5g ناموجود BioBasic
611 MOPS, free acid MB0360 100gr ناموجود BioBasic
612 MOPS, free acid MB0360-500G 500G ناموجود BioBasic
613 Melatonin MB0605 25G ناموجود BioBasic
614 MES, sodium salt MB0611 50gr ناموجود BioBasic
615 25mM MgCl2 MB1193 1.5ml ناموجود BioBasic
616 D-(+) Maltose, monohydrate MB4950 100G ناموجود BioBasic
617 Methanol MC6700 500ml ناموجود BioBasic
618 Mitomycin C MD0356M 10mg ناموجود BioBasic
619 MOPS, sodium salt MDB360S 100gr ناموجود BioBasic
620 MOPS, sodium salt MDB360S-25g None ناموجود BioBasic
621 Lambda DNA MDD22 100ug ناموجود BioBasic
622 Gibco™ EpiLife™ Medium. with 60µM calcium MEPI500CA None ناموجود Thermo
623 Gibco™ EpiLife™ CF Kit MEPICF500 None ناموجود Thermo
624 Maltose, monohydrate MIB1184 500G ناموجود BioBasic
625 Maltose, monohydrate MIB1184 100g ناموجود BioBasic
626 Premix WST-1 Cell Proliferation Assay System MK400 2500test ناموجود TaKaRa
627 LDH Cytotoxicity Detection Kit MK401 2,000 Tests ناموجود TaKaRa
628 Apoptosis Assay: In situ Apoptosis Detection Set MK500 20 Assays ناموجود TaKaRa
629 ApopLadder Ex MK600 ناموجود TaKaRa
630 Magnesium chloride, hexahydrate MRB0328 250gr ناموجود BioBasic
631 NADPH N1630 None ناموجود Sigma
632 N?-Nitro-L-arginine methyl ester hydrochloride N5751-250MG None ناموجود Sigma
633 Nisin from Lactococcus lactis-1gr N5764 None ناموجود Sigma
634 Nutrient Mixture F-10 Ham N6635-10L None ناموجود Sigma
635 β-Nicotinamide adenine dinucleotide 2′-phosphate reduced tetrasodium salt hydrate N7505 25mg ناموجود Sigma
636 pNPP-Na NB0365 5gr ناموجود BioBasic
637 Ninhydrin NB0378 25gr ناموجود BioBasic
638 Nystatin NB0390 25gr ناموجود BioBasic
639 NADH disodium salt, trihydrate, Reduced NB0642-5G 5g ناموجود BioBasic
640 N-(1-Naphthyl)-ethylenediamine dihydrochloride NB0650-10G 10g ناموجود None
641 Non-Fat Powdered Milk NB0669-100G 100g ناموجود BioBasic
642 Non-Fat Powdered Milk NB0669-50G 50g ناموجود BioBasic
643 1-Naphthaleneacetic acid NB0729 100gr ناموجود BioBasic
644 ONPG (2-Nitrophenyl β-D-galactopyranoside) ND0382 1gr ناموجود BioBasic
645 Nitrotetrazolium blue chloride (NBT) NDB0379 5gr ناموجود BioBasic
646 Nitrotetrazolium blue chloride (NBT).SIZE.5G NDB0379-5G 5g ناموجود BioBasic
647 Nonidet P-40 (NP-40) NDB0385 100ml ناموجود BioBasic
648 Nitrocellulose Membrane NT020S1-5(20X20CM) ناموجود BioBasic
649 Ovalbumin, purified O705084 1gr ناموجود BioBasic
650 L-alfa-Phosphatidylethanolamine, dioleoyl* P1223-25MG None ناموجود Sigma
651 pH Standard solution, Red pH 4.0 P2304-100ML 100ML ناموجود BioBasic
652 pH Standard solution, pH 7.0 P2307-100ML 100ML ناموجود BioBasic
653 pH Standard solution pH9.0 P2309-100ML 100ML ناموجود BioBasic
654 CA2 (Human) Recombinant Protein P3488 100ug ناموجود Abnova
655 ADIPOQ (Human) Recombinant Protein P3520 100ug ناموجود Abnova
656 Poly galactrunic acid   P3889 100gr ناموجود Sigma
657 IL4 (Human) Recombinant Protein P4558-20ug None ناموجود Abnova
658 Potassium phosphate monobasic P5379 500gr ناموجود Sigma
659 Turbo3C Protease P5380 1mg ناموجود Abnova
660 FGF21 (Human) Recombinant Protein P5989-25ug None ناموجود Abnova
661 Phenylmethanesulfonyl fluoride (PMSF) P7626 250mg ناموجود Sigma