لیست محصولات

×

آیا سوالی دارید؟ با ما تماس بگیرید.تلفن: (021)44260285(4 خط) - تلگرام: +989391127651

محصولات موجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 Serafol 2,500,000 Serafol
2 شيشه رنگ آميزي لام 350,000 None
3 perl 450,000 None
4 فيلتر سرسرنگي 0.45 استریل تک عددي عدد 180,000 MS
5 پليت 4خانه نچسب استريل عدد 300,000 Jetbiofil
6 Nitric Acid 2.5lit 4,500,000 Scharlau
7 پرل شيشه ايي-250gr 250g 950,000 ایرانی
8 رک نوک کريستالي خالي عدد 450,000 چینی
9 Rox I 40 ul 1,200,000 TaKaRa
10 رک نوک زرد همراه نوک 450,000 چینی
11 استراپر 250,000 None
12 پليت ته صاف 96 خانه استريل ST plate 55,000 None
13 Ammonium Sulfate 100G 1,800,000 Acros
14 صفحه مخصوص لام 250,000 None
15 پتري ديش 3.5 کشت سلول استريل عدد 350,000 Jetbiofil
16 فيلتر سرسرنگي 0.22 استریل تک عددي عدد 180,000 MS
17 Copper Nitrate 250gr 2,500,000 Acros
18 مگنت سایز 2 65,000 None
19 پليت 12 خانه استريل - None 190,000 SPL
20 Rox II - 100µl 1,200,000 TaKaRa
21 دي سديم هيدروژن فسفات 1Kg Acros - None 3,950,000 Acros
22 Buffer Triton X100 1000 1ml 600,000 TaKaRa
23 Buffer H 1000 None 600,000 TaKaRa
24 Buffer BSA 1000 1ml 600,000 TaKaRa
25 Apa I 1005A 10000u 9,950,000 TaKaRa
26 BOD Cell Test (BSB) 1.00687.0001 50 T 9,800,000 Merck
27 Bgl I 1000 units 1020A 1000U 4,500,000 TaKaRa
28 Dra I AhaIII 4000u TakaRa 1037A 4000u 9,950,000 TaKaRa
29 Mbo I 1069A 1000u 7,500,000 TaKaRa
30 Paraffin 107300 1kg 4,500,000 Merck
31 Hydroxyurea 10872383-1G 1g 3,950,000 Molekula
32 EcoT22I (AvaIII) 1125A 2000 u 9,500,000 TaKaRa
33 BspT104 (Asu II, Nsp V) 1225A 2500 u 7,950,000 TaKaRa
34 Sodium Carbonate 131648 1kg 2,950,000 Panreac
35 Vindoline 13940871-5MG None 5,950,000 Molekula
36 Syringic acid 14539311-10g 10g 4,950,000 Molekula
37 Syringic acid 14539311-1g 1g 1,500,000 Molekula
38 Syringic acid 14539311-25g 25g 9,500,000 Molekula
39 Syringic acid 14539311-50g 50g 15,500,000 Molekula
40 Salicylic acid 17820272-1KG 1kg 6,950,000 Molekula
41 Sillicon Cloride-500ml 201165000 500ml 8,950,000 Acros
42 Ribonuclease H (RNase H) 1000units TaKaRa 2150A 1000U 8,950,000 TaKaRa
43 Imidazole 21611083-100g 100g 4,950,000 Molekula
44 Dodecyl-beta-D-maltoside (DDM) 21771928-1G 1g 6,950,000 Molekula
45 نوک کریستالی Rnase&Dnase& pyrogen free-1000pcs- Orange 2502050 None 3,950,000 Orange
46 نوک زرد فیلتردارRnase & Dnase free-Orange 2502100 None 3,950,000 Orange
47 ميکرو تيوب 0.2 Rnse Free بسته 1000عددي Orange 25500 None 2,950,000 Orange
48 BcaBEST DNA Polymerase 300U 2770Q 300u 2,950,000 TaKaRa
49 pUC 19 DNA 3219 None 12,500,000 TaKaRa
50 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-10g 10g 2,950,000 Molekula
51 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-50g 50g 7,950,000 Molekula
52 100 bp DNA ladder 3407A 100 Rxns 16,950,000 TaKaRa
53 500 bp DNA ladder 3411A 50 µg 16,950,000 TaKaRa
54 Poly(vinyl alcohol)-25gr 363065-25G 25g 9,500,000 Sigma
55 4-Imidazolecarboxylic acid 425842 1gr 19,500,000 Sigma
56 DAB-Am-4,Polypropylenimine tetramine dendrimer, generation 1 460699 5ml 35,000,000 Sigma
57 Curcumin 49256996-1g None 1,950,000 Molekula
58 Curcumin-5g 49256996-5g None 4,500,000 Molekula
59 لوله فالکون 50 استريل RNase & DNase Freeبسته 25عددي 50050 None 975,000 SPL
60 ABTS (2.2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)diammonium salt) 51808824-1G 14,950,000 Molekula
61 Resveratrol 51852282-100MG None 4,500,000 Molekula
62 Tannic acid 52612564-100G 100g 3,500,000 Molekula
63 Tannic acid 52612564-250G 250g 6,500,000 Molekula
64 Tannic acid 52612564-50G 50g 2,500,000 Molekula
65 Resazurin sodium salt 56554686-1G 1g 3,950,000 Molekula
66 Fluorescamine 57916662-100MG 100mg 8,950,000 Molekula
67 Tet System Approved FBS 631107-50ML None 19,800,000 TaKaRa
68 Universal GenomeWalker 2.0 636405 None 180,000,000 TaKaRa
69 SeqAmp DNA Polymerase 638504 None 22,000,000 TaKaRa
70 CloneAmp HiFi PCR Premix 639298-50rxns None 5,500,000 TaKaRa
71 فلاسک کشت سلول 175cm فيلتردار استريل بسته5 عددي 71175 None 1,425,000 SPL
72 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-5G 2,950,000 Molekula
73 1,3-Dibromopropane 803279-100ml 100ml 12,500,000 Sigma
74 Topotecan hydrochloride 85474031-25MG 25mg 25,000,000 Molekula
75 Quercetin 86015335-1G 1g 14,500,000 Molekula
76 Catharanthine 89985253-5MG None 5,950,000 Molekula
77 SUPREC-01 (Rapid Recovery of DNA from Agarose Gels) 9040 100T 12,500,000 TaKaRa
78 پی پت 5 استریل-SPL 91005 None 30,000 SPL
79 10X Takara Taq Buffer (Mg2+ free) 9151AM-1ML None 1,950,000 TaKaRa
80 2X GC Buffer I 9154-1.5ml None 1,500,000 TaKaRa
81 GC Buffer II 9155 1.25ml 1,500,000 TaKaRa
82 Loading buffer 6X 9156 vials 950,000 TaKaRa
83 Loading buffer 10 X 9157 vials 950,000 TaKaRa
84 Esay Dilution 1 pak 9160 1ml 25,000,000 TaKaRa
85 Plant DNA Isolation Reagent 9194 100T 12,500,000 TaKaRa
86 NucleoCassette™ 941-0002 Pack 29,500,000 NucleoCassette
87 High Reverse Transcriptase (RNase H-, 10000 U) 9K-005-0005-10000U None 39,500,000 BioBasic
88 TBE buffer (Tris-Borate-EDTA), primix powder A0014 1PK 2,500,000 BioBasic
89 TAE buffer 25x solution A0023 1L 4,950,000 BioBasic
90 10X TBE A00269 500ML 1,950,000 BioBasic
91 TBS buffer . 10x Solution A0027-4L None 6,950,000 BioBasic
92 Arsenic(III) oxide A1010 25gr 9,500,000 Sigma
93 دی آمونیوم هیدروژن فسفات A2301 500gr 1,950,000 Applichem
94 Amoxicillin, trihydrate A762203 5gr 2,500,000 BioBasic
95 Abscisic acid (Dormin, ABA) (+) AB0001 100mg 6,950,000 BioBasic
96 Acetylcholine chloride AB0002 5G 2,500,000 BioBasic
97 ADA buffer disodium salt Ab0005-25g None 3,500,000 BioBasic
98 Alizarin yellow GG AB0011 25gr 1,950,000 BioBasic
99 Alizarin yellow R AB0012 25gr 1,950,000 BioBasic
100 Agarose M AB0013 50gr 4,500,000 BioBasic
101 Agarose B, low EEO AB0014 50 gr 5,500,000 BioBasic
102 Alkali blue 6B AB0016 25gr 3,600,000 BioBasic
103 Adenosine 5-triphosphate(ATP) disodium salt AB0020 5g 2,500,000 BioBasic
104 Ammonium bicarbonate AB0032 500gr 2,500,000 BioBasic
105 Ammonium bicarbonate AB0032-100G None 950,000 BioBasic
106 4-Aminoantipyrine AB0033-100G 100G 5,300,000 BioBasic
107 Ammonium bromide AB0057 250gr 2,950,000 BioBasic
108 Ammonium carbonate AB0058 500gr 2,550,000 BioBasic
109 Ammonium citrate, dibasic AB0059 500gr 3,300,000 BioBasic
110 Ammonium citrate, tribasic AB0060 250gr 2,250,000 BioBasic
111 Ampicillin, trihydrate AB0064-1G None 950,000 BioBasic
112 Ampicillin, trihydrate AB0064-5G None 2,500,000 BioBasic
113 Ammonium iron(II) sulfate hexahydrate AB0065 500gr 3,500,000 BioBasic
114 Ammonium molybdate tetrahydrate AB0067 50gr 1,500,000 BioBasic
115 Ammonium oxalate hydrate Ab0070-500g None 5,500,000 Molekula
116 D-Arabinose AB0071D 25G 4,500,000 BioBasic
117 L-Arabinose AB0071L 25gr 5,500,000 BioBasic
118 Ammonium phosphate, tribasic trihydrate AB0073 500G 2,500,000 BioBasic
119 Anthraquinone AB0087 25G 2,500,000 BioBasic
120 Anthrone AB0088 25gr 4,500,000 BioBasic
121 Anthrone AB0088-5g 1,500,000 BioBasic
122 L-Aspartic acid AB0091 250G 2,500,000 BioBasic
123 L-Arginine free base AB0205 100g 4,500,000 BioBasic
124 L-Arginine, monohydrochloride AB0206 100g 3,950,000 BioBasic
125 L-Arginine, monohydrochloride AB0206 500g 13,500,000 BioBasic
126 Acetamide AB0687-100g None 1,950,000 BioBasic
127 Acetosyringone AB1111 1g 7,500,000 BioBasic
128 N-Acetyl-D-glucosamine AB2245 25gr 2,500,000 BioBasic
129 Acriflavine hydrochloride AB4433 25G 3,950,000 BioBasic
130 N-Acetyl-L-Cysteine AB6697-5g None 1,950,000 BioBasic
131 Aniline AC1710 100ML 5,400,000 BioBasic
132 ABTS , di ammonium salt AD0002 1gr 7,500,000 BioBasic
133 ADA buffer AD0003-25g None 2,950,000 BioBasic
134 ACES Ad0004-25g None 2,950,000 BioBasic
135 Acriflavine, neutral AD0009 25G 3,500,000 BioBasic
136 Adenine AD0013 25gr 2,950,000 BioBasic
137 L-Alanine AD0022 100gr 3,950,000 BioBasic
138 L-Alanine .SIZE.10G AD0022-10G 10g 950,000 BioBasic
139 L-Alanine .SIZE.25G AD0022-25G 25g 1,950,000 BioBasic
140 L-Alanine .SIZE.50G AD0022-50G 50g 2,950,000 BioBasic
141 Adenine sulphate, dihydrate AD0028 25G 3,200,000 BioBasic
142 Amphotericin B AD0030P 1g 4,500,000 BioBasic
143 BSA Standard, 0.5mg/ml AD0069 2ml 1,500,000 BioBasic
144 Ammonium acetate ADB0032 500gr 2,250,000 BioBasic
145 Ammonium chloride ADB0034 500gr 1,950,000 BioBasic
146 Ammonium chloride ADB0034-250g None 1,300,000 BioBasic
147 Ammonium phosphate, dibasic ADB0040 500gr 4,350,000 BioBasic
148 Ammonium phosphate,  monobasic ADB0042 500gr 4,350,000 BioBasic
149 BSA Standard Solution AJ642.SIZE.1ML None 1,950,000 BioBasic
150 Ammonium acetate AR0032 500gr 2,550,000 BioBasic
151 AUTOCLAVE INDIcat_numberOR TAPES AT011.1ROLLS 1Rol 3,950,000 BioBasic
152 PFU DNA Polymerase, 5U/UL B0093 100u 5,950,000 BioBasic
153 PFU DNA POLYMERASE, 5U/UL.SIZE.500U B0093(D0090P)-500U None 19,500,000 BioBasic
154 Polyoxyethylene Lauryl Ether-35 (Brij 35) B0217-250G 250G 3,950,000 BioBasic
155 Bismuth (III) citrate B0466 100G 1,950,000 BioBasic
156 T4 DNA LIGASE, 5U/UL.SIZE.200U B1125-200U None 5,500,000 BioBasic
157 Imidazole – 4-carboxaldehyde 97% B25050 5gr 19,500,000 AlfaAesar
158 Bis-acrylamide BB0025 250gr 17,500,000 BioBasic
159 Bis-acrylamide BB0025 50g 3,950,000 BioBasic
160 Bis-acrylamide.SIZE.10G BB0025-10G None 1,300,000 BioBasic
161 Bromothymol blue, free acid BB0043 5G 1,650,000 BioBasic
162 BCIP toluidine salt BB0072 100MG 4,500,000 BioBasic
163 D-Biotin BB0078 1gr 2,500,000 BioBasic
164 Bis-Tris BB0079 25gr 2,500,000 BioBasic
165 Bis-Tris BB0079-100gr 100gr 7,950,000 BioBasic
166 X-Gal BB0083 100mg 2,950,000 BioBasic
167 X-Gal BB0083.SIZE.5G 5gr 45,000,000 BioBasic
168 Bacitracin zinc BB0113 5g 2,950,000 BioBasic
169 B. Extract BB0114-100g 100G 3,200,000 BioBasic
170 Barium acetate BB0116 250G 3,950,000 BioBasic
171 Benzamide BB0122 100gr 2,500,000 BioBasic
172 Benzimidazole BB0125 25gr 1,800,000 BioBasic
173 Berberine chloride BB0129.SIZE.5G None 4,500,000 BioBasic
174 BES, free acid BB0130 25G 2,700,000 BioBasic
175 BES, monosodium salt BB0131 25G 3,850,000 BioBasic
176 Betaine hydrochloride BB0133 250gr 4,950,000 BioBasic
177 Brilliant green BB0242 25gr 1,500,000 BioBasic
178 Bromocresol purple, free acid BB0244 25G 4,950,000 BioBasic
179 Bicine BB0266 100G 4,500,000 BioBasic
180 Bromocresol purple, sodium salt BB0627 5gr 1,500,000 BioBasic
181 6-Benzylamino purine BB0743-25G None 3,950,000 BioBasic
182 Basic fuchsin, certified BB1111 5gr 1,500,000 BioBasic
183 Benzoic acid BB1147 250gr 2,500,000 BioBasic
184 Bromophenol blue BB2230 25g 3,950,000 BioBasic
185 Benzaldehyde BC2140 500G 6,950,000 BioBasic
186 Bromothymol blue, sodium salt BD0048 5G 1,800,000 BioBasic
187 Bromocresol green, free acid BD0159 5G 2,950,000 BioBasic
188 1-Butanesulfonic acid sodium salt BD1237 5G 3,950,000 BioBasic
189 Bromophenol blue, sodium salt BDB0001 25g 4,500,000 BioBasic
190 تیوب 0.2میلی لیتر پی سی آر ، با درب صاف ،استریل،10 Rnase/DNase Free بسته 1000 BP541-S100 بسته 4,500,000 BioBasic
191 تیوب 0.2میلی لیتر پی سی آر ، با درب محدب ،استریل،10 Rnase/DNase Free بسته 1000 عددی BP542-S100 بسته 4,500,000 BioBasic
192 96 Well 2ml Deep Plate, Natural, Edge Filled, BR581-96N None 450,000 BioBasic
193 96 Well 2ml Deep Plate, Natural, Edge Filled, 10 P BR581-96N None 3,950,000 BioBasic
194 96 Well 2ml Deep Plate, Natural, Edge Filled, Sterile, 10 P BR581-96NS 96NS 4,950,000 BioBasic
195 EZ-10 Spin Column Total RNA Mini-preps Kit BS1361 50preps 9,950,000 BioBasic
196 DNA Blunting & Ligation Kit BS243-10 Preps None 7,950,000 BioBasic
197 EZ-10 Spin Column DNA Gel Extraction Kit BS353 50 preps 6,500,000 BioBasic
198 EZ-10 Spin Column DNA Gel Extraction Kit BS354 100 preps 9,950,000 BioBasic
199 EZ-10 Spin Column PCR names Purificat_numberion Kit BS363 50preps 6,500,000 BioBasic
200 EZ-10Spin Column PCR Products Purification Kit 100preps BS364-100preps None 9,950,000 BioBasic
201 Mammalian Protease Inhibitor Cocktail, 100x Strength Solution BS386 1ml 19,950,000 BioBasic
202 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS413 50preps 6,500,000 BioBasic
203 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS414 100 preps 9,950,000 BioBasic
204 EZ-10 Spin Column animal DNA Mini-Preps Kit BS427 50preps 6,950,000 BioBasic
205 PCR Product Cloning Kit BS435-20 preps None 8,500,000 BioBasic
206 PCR Product Cloning Kit BS436-100PREPS None 32,000,000 BioBasic
207 Fast DNA Ligation Kit(5U/UL,T4) 10RXN BS511-10RXN None 4,500,000 BioBasic
208 EZ-10 Spin Column Total RNA Mini-Preps Super Kit BS583 20preps 5,950,000 BioBasic
209 Penicillin / Streptomycin / Amphotericin B, sterile BS733 10ml 1,100,000 BioBasic
210 EZ-DNA Reagents BS8202 100 Preps 8,950,000 BioBasic
211 EZ-10 Spin Column Animal Total RNA Mini-Preps Kit BS82312 50 preps 9,950,000 BioBasic
212 EZ-10 Spin Column Blood RNA Mini-Preps Kit BS82313 50preps 13,500,000 BioBasic
213 EZ-10 Spin Column Plant RNA Mini-Preps Kit BS82314 50preps 13,500,000 BioBasic
214 EZ-10 Spin Column Yeast DNA Mini-Preps Kit BS8257 50 PREPS 9,950,000 BioBasic
215 Rapid Bacteria RNA Isolation Kit BS8625 50preps 6,950,000 BioBasic
216 All-In-one DNA/RNA/Protein Miniprep Kit BS88003 50preps 18,500,000 BioBasic
217 EZ-10 DNAaway RNA Mini-Preps Kit BS88133-50 PREPS None 18,500,000 BioBasic
218 All-In-One DNA/RNA Miniprep Kit BS88203 50preps 16,500,000 BioBasic
219 One-4-ALL Genomic DNA Miniprep Kit BS88503 50preps 15,500,000 BioBasic
220  EZ-10 Total RNA Miniprep Kit BS88583 50preps 13,500,000 BioBasic
221 EZ-10 Spin Column RNA Cleanup & Concentration Kit.SIZE.50 Pre BS91315-50prep 50Prep 11,500,000 BioBasic
222 Membrane,Nuclear & CyToplasmic Protein Extraction Kit BSP002 50preps 13,950,000 BioBasic
223 One Step Plant Active Protein Extraction Kit BSP004-20PREPS None 12,000,000 BioBasic
224 TCA Protein Precipitation Kit BSP011-50 Preps None 5,950,000 BioBasic
225 Universal Protein Sediment Reagent BSP012-100 Preps None 5,950,000 BioBasic
226 Bacterial Protein Lysis Buffer, 1x Stength Solution BSP023-25ML None 4,500,000 BioBasic
227 رک سرسمپلرکریستالی کوتاه (10-1/0 میکرو لیتر)استریل رک 96 عددی BT215-RS رک 96 عددی 580,000 BioBasic
228 رک سرسمپلرکریستالی متوسط (10-2/0 میکرو لیتر)استریل رک 96 عددی Rnase/DNase Free BT216-RS رک 96 عددی 580,000 BioBasic
229 سرسمپلرکریستالی متوسط (10-2/0 میکرو لیتر)استریل Rnase/DNase Free BT216-S 1000pcs 1,800,000 BioBasic
230 سرسمپلر آبی 1000-100میکرولیتر استریل-بسته 1000 عددی Rnase/DNase Free BT222-BS بسته 2,950,000 BioBasic
231 رک سر سمپلر آبی (100-1000) رک 100 خانه استریل RNase & DNase Free BT222-RS رک 100عددی 750,000 BioBasic
232 رک سر سمپلر زرد (200 میکرو لیتر) مدرج استریل Rnase/DNase Free BT224-RS , Rack BT224-RNS رک 96 عددی 600,000 BioBasic
233 سر سمپلر زرد (200 میکرو لیتر)مدرج استریل Rnase/DNase Free بسته هزار عددی BT224-YS بسته هزار عددی 1,950,000 BioBasic
234 رک سرسمپلرکریستالی (10-5/0 میکرو لیتر)استریل رک 96 عددی Rnase/DNase Free BT225-RS رک 96 عددی 580,000 BioBasic
235 سرسمپلرکریستالی بلند (10-5/0 میکرو لیتر)استریل بسته هزار عددی Rnase/DNase Free BT225-S 1000pcs 1,800,000 BioBasic
236 تیوب 65/0 میلی لیتر استریل ، بسته 1000 عددی Rnase/DNase Free BT613-NS 1000pcs 2,950,000 BioBasic
237 تیوب 2 میلی لیتر ته مخروطی استریل  Rnase/DNase Free بسته 1000 عددی BT619-NS 1000pcs 3,950,000 BioBasic
238 تیوب 1/5 میلی لیتر بدون رنگ دارای بسته بندی 1000تایی و استریل Rnase/DNase Free BT620-NS بسته 3,950,000 BioBasic
239 1.5ML Tube, Natural, Sterile, /Bag 100 BT620-NS-100Pak None 420,000 BioBasic
240 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G-100ul None 2,300,000 BioBasic
241 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G-200ul None 3,950,000 BioBasic
242 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G.500ul None 8,950,000 BioBasic
243 Caffeine C0150 100gr 3,500,000 BioBasic
244 Citric acid, monohydrate C2123 500gr 2,850,000 BioBasic
245 CAPS C2632 100gr 8,500,000 Sigma
246 Sodium citrate, trisodium salt, dihydrate CB0035 500gr 2,500,000 BioBasic
247 Coomassie brilliant blue R-250    CB0037 5gr 2,500,000 BioBasic
248 Coomassie brilliant blue R-250.SIZE.1G CB0037-1G None 1,100,000 BioBasic
249 Coomassie brilliant blue G-250 CB0038-100G 100G 19,950,000 BioBasic
250 Coomassie brilliant blue G-250 CB0038-25G 25G 6,500,000 BioBasic
251 Coomassie brilliant blue G-250 CB0038-5G 5G 2,500,000 BioBasic
252 Calcium carbonate, anhydrous CB0052 500gr 2,500,000 BioBasic
253 L-Cystine CB0088-100G 100G 4,500,000 BioBasic
254 Cetyldimethylethyl ammonium bromide CB0105 100gr 4,500,000 BioBasic
255 CTAB .SIZE.25G CB0108-25G 25g 1,950,000 BioBasic
256 CHES CB0115 50gr 3,200,000 BioBasic
257 Chloramphenicol CB0118 50gr 4,500,000 BioBasic
258 Chloramphenicol CB0118 250gr 17,500,000 BioBasic
259 Chloramphenicol CB0118-10G 10G 1,500,000 BioBasic
260 L-Cysteine CB0132-500g None 16,950,000 BioBasic
261 L-Cysteine hydrochloride, monohydrate CB0133 100gr 3,300,000 BioBasic
262 L-Cysteine hydrochloride. monohydrate CB0133-500 None 14,000,000 BioBasic
263 Calcium acetate monohydrate CB0249 250gr 2,950,000 BioBasic
264 Calcium Hydroxide CB0256 500gr 3,950,000 BioBasic
265 Calcium nitrate. tetrahydrate CB0258-500g None 2,950,000 BioBasic
266 Calcium phosphate, dibasic, dihydrate CB0262 500gr 3,500,000 BioBasic
267 Calcium sulfate, dihydrate CB0265 500gr 3,850,000 BioBasic
268 L-Carnitine (Vitamin BT ) CB0272 25gr 3,950,000 BioBasic
269 D-(+) Cellobiose CB0278 5gr 6,500,000 BioBasic
270 4-Chloro-1-naphthol CB0293 10gr 3,950,000 BioBasic
271 Chlortetracycline, hydrochloride CB0297 25gr 4,200,000 BioBasic
272 Cholic acid CB0298-50g None 5,950,000 BioBasic
273 Choline chloride CB0299 100G 3,200,000 BioBasic
274 Ciprofloxacin hydrochloride CB0310 25g 3,850,000 BioBasic
275 Colchicine CB0322 100mg 4,950,000 BioBasic
276 Congo Red CB0324 50gr 3,500,000 BioBasic
277 Creatine hydrate CB0326 100G 2,950,000 BioBasic
278 Creatinine CB0328 5gr 1,500,000 BioBasic
279 Creatinine CB0328-25G 25G 3,500,000 BioBasic
280 Crystal violet CB0331 25gr 1,950,000 BioBasic
281 CTAC , Cetyltrimethy lammonium chloride CB0332 100gr 3,950,000 BioBasic
282 CTAC, Cetyltrimethylammonium chloride CB0332-25g 25g 1,500,000 BioBasic
283 a-Cyclodextrin hydrate CB0348-5G 4,500,000 BioBasic
284 Cyclosporin A CB0352 250mg 3,950,000 BioBasic
285 STEM-CELLBANKER GMP grade-20ml CB046 20ml 4,950,000 TaKaRa
286 CELLOTION CB051  100ml 4,950,000 TaKaRa
287 Chitosan CB0660 100gr 5,500,000 BioBasic
288 Chitosan CB0660 500G 23,000,000 BioBasic
289 Chitosan .SIZE.50G CB0660-50g None 3,500,000 BioBasic
290 4-Chlorophenoxyacetic acid CB0720 100G 2,950,000 BioBasic
291 4-Chlorophenoxyacetic acid sodium salt CB0721 100G 2,950,000 BioBasic
292 Copper (II) acetate hydrate CB3050 100G 2,950,000 BioBasic
293 Casamino Acids CB3060 100gr 3,500,000 BioBasic
294 CASAMINO ACID CB3060-25g None 1,100,000 BioBasic
295 Copper (II) chloride hydrate CB3090 250G 3,600,000 BioBasic
296 Cresol red , sodium salt CD0037C 5gr 1,950,000 BioBasic
297 Calcium chloride, dihydrate CD0050-500G 500gr 3,500,000 BioBasic
298 CHAPS CD0110 1gr 1,950,000 BioBasic
299 CHAPSO CD0113 1gr 2,950,000 BioBasic
300 Copper (II) sulfate pentahydrate CDB0063 500G 4,500,000 BioBasic
301 Copper (II) sulfate pentahydrate CDB0063-100G 100g 1,500,000 BioBasic
302 Carbenicillin disodium CDJ469-1g None 9,500,000 BioBasic
303 10/200mm Communis Chromatography ColUMns CH001.SIZE.1 5,400,000 BioBasic
304 10/300mm Communis Chromatography Columns CH002 10/30mm 5,950,000 BioBasic
305 10/400mm Communis Chromatography Columns CH003 10/400mm 6,950,000 BioBasic
306 10/500mm Communis Chromatography Columns CH004 10/500mm 7,500,000 BioBasic
307 16/200mm Communis Chromatography Columns CH007 16/200mm 6,950,000 BioBasic
308 16/300mm Communis Chromatography Columns CH008 16/300mm 7,950,000 BioBasic
309 CARRAGEENAN CN1138 500G 6,750,000 BioBasic
310 Calcium chloride, anhydrous CT1330 500G 3,600,000 BioBasic
311 Calcium chloride, anhydrous CT1330-250g None 2,200,000 BioBasic
312 Agarose A D0012-50g 50g 4,500,000 BioBasic
313 TSG DNA Polymerase, 5U/UL D0081 200u 3,500,000 BioBasic
314 Dimethyl sulfoxide (DMSO) D0231 500ml 3,950,000 BioBasic
315 Glyoxal, 40% solution D0238 1KG 4,950,000 BioBasic
316 Dialysis tubing cellulose membrane23mm غشاء دیالیز با قطر 23mm (Molecular weight cut-off : 12400Da) D0405 Meter 1,800,000 Sigma
317 Dialysis tubing cellulose membrane32mm غشاء دیالیز با قطر 32mm (Molecular weight cut-off : 12400Da) D0530 Meter 1,800,000 Sigma
318 Dialysis tubing cellulose membrane10mm غشاء دیالیز با قطر 10mm (Molecular weight cut-off : 14KDa) D9277 Meter 1,800,000 Sigma
319 Dialysis tubing cellulose membrane43mm غشاء دیالیز با قطر 43mm (Molecular weight cut-off : 14KDa) D9527 Meter 1,800,000 Sigma
320 2'-Deoxythymidine DB0049 1gr 1,950,000 BioBasic
321 DTT DB0058 5gr 7,950,000 BioBasic
322 DTT .SIZE.1G DB0058-1g None 3,500,000 BioBasic
323 DTNB DB0113 5gr 12,500,000 BioBasic
324 DEAE, Dextran HCl-Form DB0147 10G 4,200,000 BioBasic
325 DEPC DB0154 5ml 4,500,000 BioBasic
326 DEPS DB0154-1ml None 1,950,000 BioBasic
327 2,4-Dichlorophenoxy acetic acid DB0166 100G 2,950,000 BioBasic
328 DNA & RNase Away™ DB0339 200ml 4,200,000 BioBasic
329 N-N-Dimethylglycine hydrochloride DB0412 25gr 1,950,000 BioBasic
330 DTAB,dodecyltrimethyl ammonium bromide DB0431-50G 50g 4,500,000 BioBasic
331 Sodium azide DB0613 100gr 3,950,000 BioBasic
332 Doxycycline, hydrochloride DB0889-1g None 1,100,000 BioBasic
333 Doxycycline, hydrochloride DB0889-5g None 2,950,000 BioBasic
334 Diethylamine DC3320 500ML 7,950,000 BioBasic
335 dNTP mixture (10mM) DD0056 0.5ml 2,950,000 BioBasic
336 DIPSO free acid DD0166D 25G 3,300,000 BioBasic
337 2,7-Dichlorofluorescein DD1220 5G 3,950,000 BioBasic
338 Dimethylglyoxime sodium salt DD1221-100G 100g 2,950,000 BioBasic
339 Denaturing solution DE540 1L 2,950,000 BioBasic
340 Decyl-beta-D-glucopyranoside DJ574 100MG 2,950,000 BioBasic
341 DNAfectamine DNAF001-0.3ML None 16,950,000 BioBasic
342 Silica gel with moisture indicator DSG110-1KG None 3,750,000 BioBasic
343 Silica Gel Dryer DSG111-1PK None 2,950,000 BioBasic
344 Eco Green-DNA Dye ,ready to use 1.5ml DT81414-1.5ml 1.5ml 14,950,000 BioBasic
345 Eco-Red-DNA Dye . Ready to use DT81415-1 ML 1ML 9,950,000 BioBasic
346 Eco-Stain Plus . ready to use DT81418-1 ML 1ML 16,950,000 BioBasic
347 EDTA , free acid EB0107 500gr 3,500,000 BioBasic
348 Erythromycin EB0192 25gr 7,500,000 BioBasic
349 EDTA , Iron (III), sodium salt EB0437 100gr 3,500,000 BioBasic
350 Eosin Y, sodium salt EB0441 25G 1,950,000 BioBasic
351 Erythritol EB0444 100G 4,300,000 BioBasic
352 esculin, hydrate EB0452 5G 5,500,000 BioBasic
353 EDTA zinc (II), disodium salt EB6666 100G 3,300,000 BioBasic
354 EGTA ED0077 25g 5,950,000 BioBasic
355 Bromocresol green, sodium salt ED0087 5gr 2,950,000 BioBasic
356 Eosin Y, free acid EE0190 25gr 1,950,000 BioBasic
357 Eosin Y . free acid EE0190-100g None 4,950,000 BioBasic
358 Freund’s Adjuvant, InComplete F5506 10ml 9,500,000 Sigma
359 Freund’s Adjuvant, Complete F5881 10ml 9,500,000 Sigma
360 Agar A FB0010-500G 500G 9,500,000 BioBasic
361 Agar B FB0012 100gr 2,700,000 BioBasic
362 Agar B FB0012 500G 9,950,000 BioBasic
363 Fluorescein, disodium salt FB0203 100G 2,950,000 BioBasic
364 Formamide deionized FB0211 100ml 2,950,000 BioBasic
365 D(-)-Fructose FB0213 500gr 1,950,000 BioBasic
366 Iron(II) sulfate . heptahydrate FB0461-500g None 3,950,000 BioBasic
367 Fluorescein, free acid FB0463 100G 2,950,000 BioBasic
368 Folic acid (Vitamin M) FB0466 25gr 9,500,000 BioBasic
369 Folic acid (Vitamin M) FB0466-5g None 4,950,000 BioBasic
370 5-Fluorouracil FD0080 5gr 3,950,000 BioBasic
371 Fluorene FD1223 50gr 2,950,000 BioBasic
372 نوک کریستالی فیلتردارRnase & Dnase free- GEB FT0010-B-N None 3,950,000 GEB
373 نوک زرد فیلتردار Rnase & Dnase free- GEB FT0102-B-N None 3,950,000 GEB
374 سرسمپلر فیلتردار شفاف 10- 1/0میکرولیتر بسته 1000 عددی FT215 1000pcs 4,950,000 BioBasic
375 رک سرسمپلر فیلتردار( 1000-100میکرولیتر) استریل رک 100 عددی  Rnase/DNase Free FT222-RS رک 100 خانه 980,000 BioBasic
376 رک سر سمپلر کریستالی فیلتردار(10-5/0میکرولیتر) استریل رک 96 عددی  Rnase/DNase Free FT225-RNS رک 96 عددی 800,000 BioBasic
377 Rapid Fungal DNA Isolation Kit FT71415 50preps 5,950,000 BioBasic
378 Rapid Fungal RNA Extraction Kit FT71416 50preps 6,950,000 BioBasic
379 Glucose oxidase G0243 50KU 11,000,000 BioBasic
380 Yeast Extract G0961 500gr 6,500,000 BioBasic
381 AGAR C G1253 100gr 1,950,000 BioBasic
382 Tryptone Powder G211(TG217) 100gr 2,500,000 BioBasic
383 TRYPTONE POWDER .SIZE.500G G211(TG217)-500 G 500g 8,500,000 BioBasic
384 Peptone E Gelatin Peptone G212 100gr 2,950,000 BioBasic
385 Peptone A From Meat G213 500G 7,950,000 BioBasic
386 Peptone A From Meat G213  100gr 1,950,000 BioBasic
387 Peptone D Protease Peptone G241 500G 8,950,000 BioBasic
388 Peptone D Protease Peptone G241 100gr 2,500,000 BioBasic
389 Agar D, Purified Agar G243 100G 5,500,000 BioBasic
390 Peptone F Lactalbumin Hydrolysate G256-100G None 2,500,000 BioBasic
391 PolyPeptone G258 100G 3,500,000 BioBasic
392 Peptone C Peptonized Milk G292 500G 5,950,000 BioBasic
393 Peptone C Peptonized Milk G292 100G 1,950,000 BioBasic
394 Glass beads G8772 10gr 4,800,000 Sigma
395 D(+)Galactose GB0215 100gr 4,950,000 BioBasic
396 Gentamycin sulfate   GB0217 1gr 1,500,000 BioBasic
397 Gentamycin sulfate GB0217 5gr 3,950,000 BioBasic
398 L-Glutamic acid GB0221 500gr 5,500,000 BioBasic
399 L-Glutamic acid GB0221-100g None 2,500,000 BioBasic
400 L-Glutamine GB0224 100gr 3,500,000 BioBasic
401 L-Glutamine GB0224-500G None 13,500,000 BioBasic
402 Glycerol SIZE.400ML GB0232-400ml None 2,850,000 BioBasic
403 glycine GB0235 500 gr 4,950,000 BioBasic
404 Glycine.SIZE.100G GB0235-100G 100G 1,950,000 BioBasic
405 Guanosine-5'-triphosphate [GTP], 100 mM solution GB0332 0.25ml 4,350,000 BioBasic
406 Gallic acid GB0476 250g 5,500,000 BioBasic
407 Gallic acid GB0476-100G None 2,950,000 BioBasic
408 Giemsa stain    GB0477 10gr 2,500,000 BioBasic
409 Glucose-6-phosphate, disodium salt, hydrate GB0481-1g None 4,950,000 BioBasic
410 Guanine GD0246 25gr 2,500,000 BioBasic
411 Guanosine GD0250 25gr 2,950,000 BioBasic
412 G 418 sulfate GDJ958 100mg 2,950,000 BioBasic
413 ECL™ Western Blotting Detection GERPN2209 Kit 16,500,000 None
414 DNA Marker H2 50,100,150,200,250,300,400,500,600,700,800 900 GM345.SIZE.50 load None 5,950,000 BioBasic
415 HEPES, free acid HB0264 50gr 3,500,000 BioBasic
416 HEPES, free acid HB0264 250gr 9,950,000 BioBasic
417 HEPES free acid HB0264-1KG 1Kg 36,000,000 BioBasic
418 HEPES, sodium salt HB0265 50g 3,950,000 BioBasic
419 HEPES, sodium salt HB0265-250G None 11,000,000 BioBasic
420 L-Histidine, hydrochloride.SIZE.100G HB0330-100G None 3,950,000 BioBasic
421 L-Histidine, hydrochloride.SIZE.25G HB0330-25g None 1,100,000 BioBasic
422 Histamine dihydrochloride HB0501.SIZE.25G None 8,950,000 BioBasic
423 Histamine diphosphate HB0502 5gr 2,950,000 BioBasic
424 HOBT 1-Hydroxybenzotriazole monohydrate HB0511.SIZE.50G None 6,950,000 BioBasic
425 N-Hydroxysuccinimide-5G HB0526-5G None 1,500,000 BioBasic
426 8-Hydroxyquinoline (8-Quinolinol) HD0274-25g None 3,500,000 BioBasic
427 L-Histidine, monohydrochloride, monohydrate HE806 25gr 3,950,000 BioBasic
428 L-Histidine, monohydrochloride, HE806-10G 10g 2,200,000 BioBasic
429 L-Histidine, monohydrochloride, HE806-5G None 1,400,000 BioBasic
430 ممبران استات سلولز بسته 100 عددی13 MM,0.45UM, 100/Box HP131 Pack 3,950,000 BioBasic
431 ممبران استات سلولز بسته 100 عددی 25 MM,0.45UM, 100/Box HP132 Pack 4,500,000 BioBasic
432 ممبران استات سلولز بسته 100 عددی 50 MM,0.45UM,100/Box HP133 Pack 4,950,000 BioBasic
433 5X All-In-One RT MasterMix (50ul) HRT025-10.25RXNS None 6,950,000 BioBasic
434 5X All-In-One RT MasterMix (200ul) HRT100-10.100RXNS None 19,500,000 BioBasic
435 5X All-In-One RT MasterMix (400ul) HRT200-10.SIZE.200 None 32,500,000 BioBasic
436 TAQ DNA POLYMERASE-500U HTD0078 None 3,950,000 BioBasic
437 Taq DNA Polymerase (High PURITY), 5U/UL HTD0078 200u 6,500,000 BioBasic
438 Taq DNA Polymerase (High PURITY), 5U/UL HTD0078 200u 1,950,000 BioBasic
439 4-Isothiocyanatophenyl α-D-Mannopyranoside I905135 95,000,000 TRC
440 رک 38 خانه میکروتیوب 1/5 سرماساز IB002A رک 38 عددی 1,950,000 BioBasic
441 IPTG IB0168 5gr 9,950,000 BioBasic
442 IPTG IB0168 1gr 2,950,000 BioBasic
443 INT dye IB0280 250mg 2,950,000 BioBasic
444 Indigo carmine  IB0532 10gr 1,950,000 BioBasic
445 D-myo-Inositol IB0536 100gr 3,950,000 BioBasic
446 Iodine IB0538 100gr 5,950,000 BioBasic
447 3-Indoleacetic acid (IAA) IB0723 25gr 3,950,000 BioBasic
448 3-Indole-acetic acid sodium salt IB0724 25gr 13,500,000 BioBasic
449 L-Isoleucine IB0914 50G 3,950,000 BioBasic
450 L-Isoleucine IB0914-250G 250g 12,500,000 BioBasic
451 Kanamycin sulfate KB0286 5g 2,950,000 BioBasic
452 Kanamycin sulfate KB0286 100G 29,500,000 BioBasic
453 Kanamycin sulfate 1g KB0286-1G None 950,000 BioBasic
454 Kanamycin sulfate.SIZE.25G KB0286-25G 25gr 8,500,000 BioBasic
455 Kanamycin sulfate 700mg KB0286-700mg None 850,000 BioBasic
456 Kinetin KB0745 100G 19,500,000 BioBasic
457 Kinetin KB0745 25gr 5,500,000 BioBasic
458 2-Ketoglutaric acid KD0290 100gr 4,500,000 BioBasic
459 Lysostaphin  from  Staphylococcus  staphyloly L7386-1MG 1mg 16,950,000 Sigma
460 Lincomycin hydrochloride LB0604-25G 25G 4,500,000 BioBasic
461 D-Lactose, monohydrate LC4280 500gr 4,950,000 BioBasic
462 Lysozyme .SIZE.5G LDB0308 7,950,000 BioBasic
463 Lysozyme LDB0308 1gr 2,500,000 BioBasic
464 Lysozyme LDB0308-25G None 34,000,000 BioBasic
465 Lysozyme 600mg LDB0308-600mg None 1,750,000 BioBasic
466 500bp-10kb Ladder ready to use.SIZE.100 loading M101R-1-100 loading None 6,950,000 BioBasic
467 DNA Marker Wide Range,Ready to use (100bp-10Kb) M103R-1 100 loading 8,950,000 BioBasic
468 Lamda DNA / HindIII Marker, Ready to use7 DNA fragments : 23130*, 9416, 6557, 4361*, 2322, 2027 & 564 M104R-1 100 loading 3,500,000 BioBasic
469 100+50bpDNA Marker,Ready-to-use:11 DNA fragments:150,250,350,450,550,650,750,850,1000,1500bp M109-A 100 Loading 6,950,000 BioBasic
470 F8 monoclonal antibody, clone 101 MAB4180 100 ug 39,500,000 Abnova
471 Magnesium acetate, tetrahydrate MB0326 500gr 2,950,000 BioBasic
472 Magnesium chloride, hexahydrate MB0328 500gr 3,500,000 BioBasic
473 Magnesium chloride, hexahydrate.SIZE.100G MB0328-100G 100G 1,100,000 BioBasic
474 Manganese chloride, tetrahydrate MB0331 1KG 4,800,000 BioBasic
475 DL-Malic acid MB0333 250gr 1,500,000 BioBasic
476 Manganese sulfate, monohydrate MB0334 500G 3,600,000 BioBasic
477 D-Mannitol MB0335 100gr 1,950,000 BioBasic
478 MES, free acid, monohydrate MB0341-100G 100g 6,950,000 BioBasic
479 MES, free acid, monohydrate MB0341-5G 5G 1,500,000 BioBasic
480 Methylene blue, chloride, trihydrate.SIZE.50G MB0342 None 2,500,000 BioBasic
481 L-Methionine MB0346 25gr 3,950,000 BioBasic
482 Molybdic acid, sodium salt MB0358 50gr 2,950,000 BioBasic
483 D-Mannose MB0554 100G 12,000,000 BioBasic
484 Manganese acetate, tetrahydrate MB0600 250G 2,300,000 BioBasic
485 Menthol MB0608 50gr 3,200,000 BioBasic
486 Methylamine hydrochloride MB0613 100G 3,200,000 BioBasic
487 Methyl blue, sodium salt MB0614 50g 2,500,000 BioBasic
488 Methyl red  MB0627 25gr 2,500,000 BioBasic
489 Methyl red sodium salt MB0628 25G 2,950,000 BioBasic
490 Mycophenolic acid MB0640 1gr 3,950,000 BioBasic
491 MU-Gal MB1136 250mg 4,500,000 BioBasic
492 MgCl2 1.5ml MB1193-1.5ml 1.5ml 950,000 BioBasic
493 MUG MB2251-250MG 250mg 4,200,000 BioBasic
494 Malachite green oxalate MD0330 50G 1,950,000 BioBasic
495 Mucic acid MD1225 50gr 3,950,000 BioBasic
496 MOPSO, sodium salt MDB0095 25gr 2,950,000 BioBasic
497 MOPS, sodium salt MDB360S 100gr 8,500,000 BioBasic
498 MOPS, sodium salt MDB360S-25g None 3,500,000 BioBasic
499 MOPS, sodium salt MDB360S-5g None 1,500,000 BioBasic
500 Malt Extract MJ873(G257) 100gr 2,500,000 BioBasic
501 Magnesium sulfate, heptahydrate, biotech MRB0329 500gr 2,950,000 BioBasic
502 NADP N0760 250MG 6,950,000 BioBasic
503 L-Norleucine N2857 5G 5,950,000 BioBasic
504 L-Norvaline N4058 5G 1,950,000 BioBasic
505 Neomycin sulfate NB0366 25gr 4,950,000 BioBasic
506 Neomycin sulfate NB0366-5g None 1,950,000 BioBasic
507 Ninhydrin NB0378 25gr 4,200,000 BioBasic
508 Ninhydrin NB0378-1g None 950,000 BioBasic
509 Ninhydrin NB0378-5g None 1,950,000 BioBasic
510 Nystatin NB0390 5gr 3,950,000 BioBasic
511 NAD-Trihydrate NB0641 1gr 3,500,000 BioBasic
512 NADH disodium salt, trihydrate, Reduced NB0642 1gr 6,500,000 BioBasic
513 Neutral red NB0652 25gr 3,950,000 BioBasic
514 Neutral red NB0652-5g None 1,500,000 BioBasic
515 Nicotinamide NB0659 250gr 4,200,000 BioBasic
516 Nicotinic acid (NIACIN) NB0660 250gr 4,200,000 BioBasic
517 NON-Fat Powdered Milk NB0669 250g 4,500,000 BioBasic
518 β-Naphthoxyacetic acid NB0731 100gr 2,950,000 BioBasic
519 Nalidixic acid ND0363 25g 3,950,000 BioBasic
520 Nalidixic acid .SIZE.5G ND0363-5g None 1,500,000 BioBasic
521 1-Nitro-2-naphthol-3,6 ND1226 25G 2,950,000 BioBasic
522 Nitrotetrazolium blue chloride (NBT) NDB0379 250mg 3,500,000 BioBasic
523 Nitrotetrazolium blue chloride (NBT) NDB0379 1gr 11,000,000 BioBasic
524 Nitrotetrazolium blue chloride (NBT).SIZE.800MG NDB0379-800mg None 9,500,000 BioBasic
525 Nonidet P-40 (NP-40) NDB0385 100ml 2,950,000 BioBasic
526 Orange II O14Z25 25gr 1,950,000 BioBasic
527 Protein Standard 2mg/ml, Ovalbumin O715080 2ml 1,800,000 BioBasic
528 Ofloxacin OB0673-25G 25G 3,500,000 BioBasic
529 Orange G, sodium salt OB0674 25gr 2,950,000 BioBasic
530 Oxacillin, sodium salt OB0677-25G 25G 12,000,000 BioBasic
531 Oligo dT cellulose OB1142 100mg 3,950,000 BioBasic
532 L-Ornithine, monohydrochloride OB7771 25gr 2,950,000 BioBasic
533 Oil Red O OD0395 50g 3,300,000 BioBasic
534 Oxalic acid. dihydrate OD0400-250g None 2,500,000 BioBasic
535 Pyronin B P0724 5gr 4,350,000 BioBasic
536 pH Standard solution pH11.0 P2311 100ml 3,300,000 BioBasic
537 Polygalacturonic acid 85% 25gr Sigma P3889-25g None 17,500,000 Sigma
538 Polygalacturonic acid 85% 5gr Sigma P3889-5g None 4,500,000 Sigma
539 Trypsin (Bovine), Modified, Sequencing Grade P5320 4*25ug 12,500,000 Abnova
540 Penicillin G, sodium salt PB0135 100gr 9,500,000 BioBasic
541 Penicillin G, sodium salt PB0135 25gr 3,950,000 BioBasic
542 Penicillin G, sodium salt.SIZE.5G PB0135-5g None 1,950,000 BioBasic
543 Pepsin 1: 3000 PB0411 100gr 7,950,000 BioBasic
544 Phenol red PB0420 25gr 4,500,000 BioBasic
545 Phenol red PB0420-5G 5g 1,500,000 BioBasic
546 L-Phenylalanine.SIZE.50G PB0422-50gr 50g 2,950,000 BioBasic
547 PEG 4000 PB0431 500gr 3,500,000 BioBasic
548 PEG4000.SIZE.100G PB0431-100g None 1,100,000 BioBasic
549 PEG 6000 PB0432 500gr 3,500,000 BioBasic
550 PVP-40 (Polyvinylpyrrolidone) PB0436 250gr 3,950,000 BioBasic
551 Ponceau S PB0437 25gr 2,950,000 BioBasic
552 Potassium acetate PB0438 500gr 3,850,000 BioBasic
553 Potassium carbonate, anhydrate PB0439 500G 3,600,000 BioBasic
554 Potassium chloride PB0440 500gr 3,200,000 BioBasic
555 Potassium chloride PB0440-100G 100G 1,100,000 BioBasic
556 Potassium iodide   PB0443 50gr 2,950,000 BioBasic
557 Potassium phosphate, monobasic, anhydrous PB0445 500gr 3,950,000 BioBasic
558 Potassium Phosphat,Monobasic -100G PB0445-100G 100G 1,200,000 BioBasic
559 Potassium sorbate PB0446 100gr 1,500,000 BioBasic
560 Potassium phosphate, dibasic, anhydrous PB0447 500gr 3,950,000 BioBasic
561 Proteinase K PB0451 50mg 4,950,000 BioBasic
562 Proteinase K .SIZE.250MG PB0451-250MG 250mg 19,500,000 BioBasic
563 Pancreatin-5.0 (5XUSP) from hog pancreas PB0680-50G None 3,950,000 BioBasic
564 Pancreatin-8.0 PB0681-100G 100g 5,950,000 BioBasic
565 D-Pantothenic acid hemicalcium salt (Vitamin B5) PB0683 100gr 3,950,000 BioBasic
566 Peroxidase,horseradish 100mg PB0691-100MG 100MG 19,500,000 BioBasic
567 Pluronic F-127 PB0750 100G 9,750,000 BioBasic
568 Potassium sulfate, anhydrous PB0782 500G 4,300,000 BioBasic
569 Protein A PB0789 10mg 5,500,000 BioBasic
570 Pyridoxal hydrochloride PB0795 5gr 3,950,000 BioBasic
571 L-Proline PB0923-100G 100gr 3,600,000 BioBasic
572 POPSO, disodium salt PB4959 25G 5,400,000 BioBasic
573 POPSO, free acid PB4979 25G 3,500,000 BioBasic
574 Potassium sulfite PB6688 500gr 4,300,000 BioBasic
575 Paraffin oil (Mineral oil), extra heavy fraction PC5532 100ml 1,800,000 BioBasic
576 Pyrogallol ( 1,2,3-Trihydroxybenzene) PC6880 100gr 8,500,000 BioBasic
577 10x Taq Buffer (MgCl2)1.5ml PCRB16-1.5ml 950,000 BioBasic
578 10x Taq Buffer (NH4)2SO4.SIZE.1.5ml PCRB55-1.5ML 950,000 BioBasic
579 10x Taq Buffer.SIZE.1.5ml PCRB60-1.5ml 1.5ml 950,000 BioBasic
580 Phenol red, sodium salt PD0424 25gr 3,200,000 BioBasic
581 PBS PD0435 1 tablet 85,000 BioBasic
582 Potassium ferricyanide PD0442 100gr 2,950,000 BioBasic
583 Propylene glycol ( 1,2-Propanediol) PD0450 500ml 1,950,000 BioBasic
584 Phosphotungstic acid hydrate PD1241 25gr 3,950,000 BioBasic
585 PIPES, sodium salt PDB0434 100G 7,800,000 BioBasic
586 Phosphatase Inhibitor Cocktail II PL019-1ml None 2,950,000 BioBasic
587 Proflavine hydrochloride PN1227 25G 5,950,000 BioBasic
588 Blotting Paper, 10x15cm, 100 SHEETS PP3322 None 9,500,000 BioBasic
589 Blotting Paper, 15x15cm, 100 SHEETS PP3323 None 9,950,000 BioBasic
590 Gel Blot Paper . 20x20 cm PP3324-1PK None 12,000,000 BioBasic
591 Potassium acetate.SIZE.500G PRB0438 3,950,000 BioBasic
592 Potassium bromide PT0762 500G 4,650,000 BioBasic
593 Potassium oxalate, monohydrate PT0774 500G 5,850,000 BioBasic
594 Potassium bicarbonate PT1195 500G 2,300,000 BioBasic
595 Rapid Plant RNA Isolation Kit PT4191 50preps 6,950,000 BioBasic
596 Quinine hemisulfate salt monohydrate QB0802 25G 4,500,000 BioBasic
597 Quinine sulfate, dihydrate QB0803 25G 3,300,000 BioBasic
598 Green-2-Go 2X qPCR-S Mastermix QPCR004-S-1.25ML None 6,950,000 BioBasic
599 Green-2-Go TaqProbe qPCR Mastermix-no Dye ) QPCR005-NODYE.1.25ML None 6,950,000 BioBasic
600 Green-2-Go 1-Step qRT-PCR Mastermix-No Dye (100X20ul Rxn) QPCR007-NODYE.100 None 28,000,000 BioBasic
601 Hs-ALPL-1-SG QuantiTect primer assay QT00012957 Pack 12,000,000 Qiagen
602 Hs-SPARC-1-SG QuantiTect primer assay QT00018620 Pack 12,000,000 Qiagen
603 Hs-RB1-1-SG QuantiTect primer assay QT00066899 Pack 12,000,000 Qiagen
604 Hs-BGLAP-1-SG QuantiTect primer assay QT00232771 Pack 12,000,000 Qiagen
605 Hs-SPP1-1-SG QuantiTect primer assay QT01008798 Pack 12,000,000 Qiagen
606 Taq DNA polymerase 50 unit R001Q None 3,950,000 TaKaRa
607 جعبه 5 خانه مخصوص تیوب سانتریفیوژ(تیوب 5/1 یا 2 میلی لیتر) R005-G Pack 400,000 BioBasic
608 جعبه 5 خانه مخصوص تیوب سانتریفیوژ (ویال شیشه ای 3 میلی لیتر) R006-G Pack 400,000 BioBasic
609 جعبه 5 خانه مخصوص تیوب سانتریفیوژ (ویال شیشه ای 10 میلی لیتر) R007-G Pack 400,000 BioBasic
610 TaKaRa Taq Hot Start 50 units R007Q None 4,950,000 TaKaRa
611 Rosaniline chloride R2770 25gr 2,500,000 BioBasic
612 کاور مخصوص رک 80 خانه دورو  بدون رنگ R567-C Pack 450,000 BioBasic
613 کاور مخصوص رک 96 خانه دورو  بدون رنگ R577-C Pack 450,000 BioBasic
614 رک میکروتیوب0.2درب لولایی رک153خانه- Globall Roll Rack0.2 None 300,000 Global Roll
615 رک میکروتیوب0.5درب لولایی رک98خانه- Globall Roll Rack0.5 None 300,000 Global Roll
616 رک میکروتیوب1.5درب لولایی رک72خانه- Globall Roll Rack1.5 None 300,000 Global Roll
617 Rhodamine B RB0464 100gr 3,950,000 BioBasic
618 RNase A RB0473 25mg 2,950,000 BioBasic
619 Rubidium chloride RB0668 25gr 16,500,000 BioBasic
620 Ribostamycin sulfate salt RB0807 5gr 3,200,000 BioBasic
621 Rifampicin RB0808 25g 8,950,000 BioBasic
622 Rifampicin RB0808-5G None 2,500,000 BioBasic
623 Rose Bengal, sodium salt RB0809 50gr 9,500,000 BioBasic
624 Rose Bengal, sodium salt RB0809-10G 10G 2,950,000 BioBasic
625 Rose Bengal, sodium salt RB0809-25gr 25gr 5,500,000 BioBasic
626 Multi-channel Reagent Boat 100 ml (Reservoir) RB333 Pack 350,000 BioBasic
627 2 x RIPA Buffer I ( pH 7.4) 2 x concentrate RB4475 500ml 3,950,000 BioBasic
628 2 x RIPA Buffer II (Ph8.0)2x concentrate RB4476 500ml 3,950,000 BioBasic
629 Recombinant Vascular Endothelial Growth Factor165 RC216-16.SIZE.2UG None 9,750,000 BioBasic
630 Riboflavin 25g RD0470-25g None 1,950,000 BioBasic
631 D-Ribose RD0475 25gr 2,500,000 BioBasic
632 Sodium sulfate, anhydrate RD0489 2.5KG 8,550,000 BioBasic
633 Sodium sulfate, anhydrate RD0489-500G 500G 2,500,000 BioBasic
634 Raffinose, pentahydrate RJ392 25gr 5,500,000 BioBasic
635 TaKaRa EX Taq Hot Start 250 units RR006A None 22,000,000 TaKaRa
636 TaKaRa EX Taq Hot Start 50 units RR006Q None 5,950,000 TaKaRa
637 TaKaRa EX Taq Hot Start 20 units RR006Q-20U None 2,950,000 TaKaRa
638 Real Time one step RNA PCR kit, Version 2 RR026 100 Test 22,000,000 TaKaRa
639 TaKaRa LA Taq HS (dNTP inclus) RR042Q None 7,500,000 TaKaRa
640 سل شیشه ای با درب حجم 1.7 میلی لیتر به ابعاد45*12.5*7.5 میلیمتر S003-G Pack 1,500,000 BioBasic
641 سل شیشه ای با درب به ابعاد 45*12.5*12.5 میلیمتر با حجم 3.5 میلی متر S004-G Pack 1,500,000 BioBasic
642 Sodium thioglycolate S0265 100G 4,950,000 BioBasic
643 Sodium phosphate, dibasic ,anhydrous S0404 500gr 3,500,000 BioBasic
644 Sudan black B S0593 5gr 1,500,000 BioBasic
645 Spermidine trihydrochloride S714272 5,500,000 BioBasic
646 Sodium sulfate, anhydrate SB0298 500G 1,800,000 BioBasic
647 Sodium chloride SB0476 1kg 1,950,000 BioBasic
648 Sodium chloride.SIZE.5KG SB0476-5KG 5kg 7,950,000 BioBasic
649 Sodium acetate, trihydrate SB0481 500g 1,950,000 BioBasic
650 Sodium bicarbonate SB0482 500g 1,800,000 BioBasic
651 Sodium acetate 3M solution SB0483 500ml 1,500,000 BioBasic
652 D-Sorbitol .SIZE.100G SB0491-100g None 850,000 BioBasic
653 Streptomycin sulfate SB0494 50gr 3,950,000 BioBasic
654 Streptomycin sulfate .SIZE.10G SB0494-10g None 1,500,000 BioBasic
655 Sucrose SB0498 500gr 1,800,000 BioBasic
656 Sucrose SB0498-2.5KG None 6,950,000 BioBasic
657 5-Sulfosalicylic acid, dihydrate SB0610 50gr 1,600,000 BioBasic
658 5-Sulfosalicylic acid, dihydrate SB0610 250gr 5,950,000 BioBasic
659 Sodium oxalate SB0829 500G 9,300,000 BioBasic
660 Sodium L-ascorbate SB0830 100gr 2,500,000 BioBasic
661 Sodium benzoate SB0833 500gr 2,500,000 BioBasic
662 Sodium bisulfite SB0834 500gr 2,950,000 BioBasic
663 Sodium bromide SB0837 250gr 2,950,000 BioBasic
664 Sodium butyrate SB0838 5gr 2,500,000 BioBasic
665 Sodium cholate, hydrate SB0841 25gr 3,950,000 BioBasic
666 Cromolyn sodium salt SB0843 5G 3,300,000 BioBasic
667 Sodium diphenylamine-4-sulfonate SB0847-10g None 9,500,000 BioBasic
668 Sodium diphenylamine-4-sulfonate SB0847-25g None 19,500,000 BioBasic
669 Sodium diphenylamine-4-sulfonate SB0847-5g None 4,950,000 BioBasic
670 Sodium metabisulfite SB0862 500gr 2,500,000 BioBasic
671 Sodium periodate SB0875 25gr 2,500,000 BioBasic
672 Sodium phosphate, monobasic, anhydrous SB0878 500gr 3,950,000 BioBasic
673 Sodium phosphate, monobasic, dihydrate SB0879 500gr 3,500,000 BioBasic
674 Sodium pyruvate SB0884 100gr 4,500,000 BioBasic
675 Sodium pyruvate SB0884 10gr 1,500,000 BioBasic
676 Sodium salicylate SB0885 250G 2,700,000 BioBasic
677 Sodium succinate, dibasic, hexahydrate SB0889 500G 6,300,000 BioBasic
678 Sodium Thiocyanate SB0897 250gr 2,950,000 BioBasic
679 Sorbic acid SB0899 500G 4,500,000 BioBasic
680 Spermine tetrahydrochloride SB0902 1gr 5,850,000 BioBasic
681 Starch soluble SB0904 500gr 3,750,000 BioBasic
682 Sudan IV (sudan Red 4) SB0914 25G 1,950,000 BioBasic
683 Sulfur sublimed SB0917 250gr 2,500,000 BioBasic
684 L-Serine SB1479 25gr 3,500,000 BioBasic
685 L-Serine SB1479-10G 10g 1,950,000 BioBasic
686 L-Serine SB1479-5G 5g 1,100,000 BioBasic
687 Sodium acetate, anhydrate SB1611 500gr 3,200,000 BioBasic
688 Saponin SB4521 25gr 2,600,000 BioBasic
689 Sodium Bismuthate SB7820 25gr 5,700,000 BioBasic
690 Sodium bisulfate, monohydrate SB7834 500G 2,950,000 BioBasic
691 Succinic anhydride SB7835-250g None 2,950,000 BioBasic
692 Sodium phosphate, tribasic, dodecahydrate SC8240-500g None 3,950,000 BioBasic
693 Sodium thiosulfate, pentahydrate SD0256 500gr 2,100,000 BioBasic
694 Sodium borate, decahydrate SD0480 500gr 1,950,000 BioBasic
695 Succinic acid SD0496 500gr 4,200,000 BioBasic
696 پلیت DNA 96 خانه با غشاء(960 میکرو مول) SD5007 plate 2,100,000 BioBasic
697 LB Agar Broth SD7003(S519) 250gr 3,950,000 BioBasic
698 LB AGAR BROTH SD7003(S519)-100g None 2,500,000 BioBasic
699 LB AGAR BROTH SD7003(S519)-50g None 1,500,000 BioBasic
700 LB-Top Agar SD7004-250g None 3,950,000 BioBasic
701 LB BROTH LENNOX.SIZE.250G SD7005(S516) None 3,950,000 BioBasic
702 LB Lennox Agar SD7006-250g None 3,950,000 BioBasic
703 SOB BROTH.SIZE.250G SD7007 None 3,950,000 BioBasic
704 Sob Agar SD7008 250gr 3,950,000 BioBasic
705 NZCYM Broth SD7010 100G 2,600,000 BioBasic
706 NZCYM Agar SD7011 100G 2,600,000 BioBasic
707 NZYM Broth SD7012 100G 2,300,000 BioBasic
708 NZYM Agar SD7013 100G 2,600,000 BioBasic
709 NZM Broth SD7014 100G 2,300,000 BioBasic
710 NZM Agar SD7015 100G 2,600,000 BioBasic
711 YT Broth SD7016-250g None 3,950,000 BioBasic
712 YT Agar SD7017-250g None 4,500,000 BioBasic
713 2x YT Agar SD7020-250g None 3,950,000 BioBasic
714 2x YT Top Agar SD7021-250g None 3,950,000 BioBasic
715 YPD Broth SD7022-250g None 3,950,000 BioBasic
716 YPD Agar SD7023-250g None 3,950,000 BioBasic
717 M9 Medium SD7024 250G 3,950,000 BioBasic
718 YM Medium SD7031 250G 3,950,000 BioBasic
719 YM Agar SD7034 250G 4,950,000 BioBasic
720 TERRIFIC BROTH.SIZE.250G SD7035(DJ980) None 3,950,000 BioBasic
721 EDTA 0.5M sterile solution SD8135 450ml 3,950,000 BioBasic
722 Sodium lauroyl sarcosine SDB0486-50g None 1,950,000 BioBasic
723 Sodium phosphate, dibasic, heptahydrate.SIZE.100G SDB0487-100G 100G 1,100,000 BioBasic
724 Sodium carbonate,anhydrous 2.5kg SDB0615 8,950,000 BioBasic
725 Sodium carbonate, anhydrous SDB0615 500g 2,500,000 BioBasic
726 Sodium carbonate, anhydrous.SIZE.100G SDB0615-100g None 950,000 BioBasic
727 Sudan Red 7 B SJ227 10gr 3,300,000 BioBasic
728 Sulfobetaine 8 SJ547 1gr 2,950,000 BioBasic
729 Sulfobetaine 10 SJ548 1gr 3,200,000 BioBasic
730 Sulfobetaine 12 SJ550 1gr 3,200,000 BioBasic
731 Lowry Protein Assay Kit SK4031-1000 Assays None 4,500,000 BioBasic
732 EZ-10 Spin Column Blood Genomic DNA MiniPreps Kit SK8253 50preps 7,500,000 BioBasic
733 EZ-10 Spin Column Blood Genomic DNA MiniPreps Kit SK8254 100 PRE 14,500,000 BioBasic
734 EZ-10 Spin Column Plant Genomic DNA Mini-Preps Kit SK8262 100 PREPS 13,950,000 BioBasic
735 SanPrep Column microRNA Mini-Preps Kit SK8811 50PRES 11,000,000 BioBasic
736 قاشقک استیل 180 میلیمتر SP064 Pack 1,350,000 BioBasic
737 اسکوپ استیل 160 میلیمتر SP072 Pack 900,000 BioBasic
738 میکرو اسپاتول تخت  با انتهای گرد 160 میلیمتر SP075 Pack 1,100,000 BioBasic
739 پیمانه استیل بزرگ SP076 Pack 1,800,000 BioBasic
740 پیمانه استیل متوسط SP077 Pack 1,800,000 BioBasic
741 سل کوارتز UV استاندارد با درب تفلونی دو طرف مات با ابعاد 45*12.5*12.5 و حجم 3.5 میلی لیتر SQ014 Pack 13,500,000 BioBasic
742 سل کوارتز با درب ساده 4 طرف مات به ابعاد 45*12.5*12.5 میلیمتر با حجم 0.7 میلی لیتر UV میکرو SQ244 عدد 7,500,000 BioBasic
743 سل کوارتز با درب تفلونی 4 طرف مات به ابعاد 45*12.5*12.5 میلیمتر و حجم 1.4 میلی لیتر UV سمی میکرو SQ294 عدد 11,000,000 BioBasic
744 Sodium acetate SRB1611 500gr 3,500,000 BioBasic
745 GDF9 human 20ug Sigma SRP4872 None 55,000,000 Sigma
746 Thiazoyl blue tetrazolium bromide (MTT) T0793-500mg 500mg 4,950,000 BioBasic
747 Retro Nectin Dish 1 plate T110A None 4,950,000 TaKaRa
748 Tris-(hydroxymethyl) propane T1491-100g None 4,950,000 BioBasic
749 TNBT (Titanium(IV) butoxide) T6756 250MG 6,950,000 BioBasic
750 Western BLoT Immuno Booster Sample T7111Q 20ml 1,950,000 TaKaRa
751 Western BLoT Rapid Detect Sample T7121Q 2test 2,950,000 TaKaRa
752 Trimethoprim T714206 5g 3,500,000 BioBasic
753 One-Tube Swab DNA Extraction Kit T71612 20preps 3,950,000 BioBasic
754 PBS T900 1Tablets 95,000 TaKaRa
755 Tris-Glycine-SDS powder T901 Pack 550,000 TaKaRa
756 Tris Glycin powder T902 Pack 450,000 TaKaRa
757 L-broth powder T904 Pack 550,000 TaKaRa
758 Tris hydrochloride TB0103 250gr 4,500,000 BioBasic
759 TES, sodium salt TB0124 25G 3,600,000 BioBasic
760 Tris  TB0194 2.5kg 25,500,000 BioBasic
761 Tris  TB0194 500gr 5,500,000 BioBasic
762 Tris TB0194-100g None 1,950,000 BioBasic
763 Tris TB0194-50g None 1,100,000 BioBasic
764 Triton X-100 TB0198 500ml 2,500,000 BioBasic
765 TMB dihydrochloride TB0514 1gr 4,500,000 BioBasic
766 TMB dihydrochloride.SIZE.5G TB0514 None 17,500,000 BioBasic
767 Polyoxyethylene-20 (TWEEN 20) TB0560 500ml 2,950,000 BioBasic
768 2,3,5-Triiodobenzoic acid TB0735 5gr 2,950,000 BioBasic
769 L-Threonine TB0919 100gr 4,500,000 BioBasic
770 TAPS, sodium salt TB0920 50G 4,500,000 BioBasic
771 L-Tartaric acid TB0925 500G 7,950,000 BioBasic
772 Taurine TB0926 100gr 3,950,000 BioBasic
773 TES, free acid TB0927 50G 5,400,000 BioBasic
774 Thymine TB0943-100g None 7,500,000 BioBasic
775 Thymol blue, free acid TB0944 25G 5,950,000 BioBasic
776 Thymolphthalein TB0945 25G 4,800,000 BioBasic
777 Thymol TB0946 25gr 3,300,000 BioBasic
778 Tiron TB0951 25G 4,950,000 BioBasic
779 Toluidine Blue O TB0962 5G 2,950,000 BioBasic
780 L-Tryptophan TB1911-1g None 850,000 BioBasic
781 L-Tryptophan TB1911-5g None 1,750,000 BioBasic
782 L-Tryptophan TB1911-800mg None 750,000 BioBasic
783 TAPS, free acid TB3566 50G 2,950,000 BioBasic
784 تیوب 5/1 میلی لیتر ته مخروطی با درب پیچی آبی ،استریل ، Rnase/DNase Free بسته پانصد عددی TC153-SB  500pcs 4,950,000 BioBasic
785 تیوب 65/1 میلی لیتر ته مخروطی با درب پیچی قرمز ،استریل Rnase/DNase Free، بسته پانصد عددی TC154-SR 500pcs 4,950,000 BioBasic
786 1.5ML CONICAL TUBE WITH SCREWCAP, AMBER,500/BAG TC157-A 500/BAG 4,950,000 BioBasic
787 1.5ML CONICAL TUBE WITH SCREW CAP, STERILE, GREEN,500/BAG TC157-SG 4,950,000 BioBasic
788 Tris acetate TD0101-25gr 25gr 1,600,000 BioBasic
789 Culture Tube, 12 ml, Natural, Dual Cap, Sterile TD444-S.SIZE.1PK None 1,800,000 BioBasic
790 Triton X-114.SIZE.500ML TDB0554 500ml 3,200,000 BioBasic
791 1.5ML SKIRTED TUBE WITH SCREWCAP, STERILE, NATURAL,500/BAG TK352-SN None 4,950,000 BioBasic
792 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, BLUE,500/BAG TK353-SB None 4,950,000 BioBasic
793 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, RED,500/BAG TK354-SR None 4,950,000 BioBasic
794 1.5ML Skirted Tube With Screw Cap, Amber, 500/Bag TK357-A بسته 6,950,000 BioBasic
795 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, GREEN,500/BAG TK357-SG None 4,950,000 BioBasic
796 Thymol blue, sodium salt TN1195 25G 6,950,000 BioBasic
797 Triton X-405 TS4449 100ML 4,500,000 BioBasic
798 غلطک پلیت با دسته چوبی TSM113 Pack 1,400,000 BioBasic
799 Trypan Blue TT1140 10g 3,500,000 BioBasic
800 Uracil UD0564 100gr 3,500,000 BioBasic
801 Uridine UD0570 25gr 8,500,000 BioBasic
802 L-Valine VB0172 500G 21,000,000 BioBasic
803 L-Valine 100G VB0172-100G 100G 4,950,000 BioBasic
804 L-Valine 250G VB0172-250G 250G 13,500,000 BioBasic
805 Vancomycin hydrochloride VB0983 1g 7,500,000 BioBasic
806 Victoria blue B VB0985 25gr 2,950,000 BioBasic
807 Rapid Viral RNA Extraction Kit VT4184 50preps 16,500,000 BioBasic
808 Wright's stain (Eosin methyl blue) WB0989 25gr 5,500,000 BioBasic
809 Xylene cyanol FF XB0005-5G None 2,500,000 BioBasic
810 Xylenol orange XB0996 10G 6,950,000 BioBasic
811 Xylitol XB0997 100gr 2,500,000 BioBasic
812 بطری پلاستیکی برای شستشو/درب آبی-قابل اتوکلاو(پی ست) XP001 Pack 550,000 BioBasic
813 Zymosan A ZB4250 100 mg 5,950,000 BioBasic

محصولات ناموجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 فلاسک T75 بسته 5عددي فيلتر دار Biofil کانادا 5 pcs ناموجود Jetbiofil
2 Prime STAR (high fidelity PCR) 50 u None ناموجود TaKaRa
3 Sodium Chloride 5KG ناموجود Acros
4 فلاسک کشت سلول 12.5cm سادهbiofil کانادا 10 pcs ناموجود Jetbiofil
5 Chloroform 1lit ناموجود Merck
6 پنبه غیر استریل بسته ناموجود ایرانی
7 سمپلر متغيير 500 الي 5000 Unit ناموجود None
8 Sodium Hydroxide 1KG ناموجود Merck
9 Acrylamide 100g ناموجود Acros
10 Buffer Z None ناموجود TaKaRa
11 سنتز پرايمر Page 100nmol None ناموجود BioBasic
12 فلاسک T25 بسته 10 عددي فيلتر دار Biofil کانادا 10 pcs ناموجود Jetbiofil
13 گلايسين 50gr ايراني ناموجود ایرانی
14 Bis Acrylamid 25g ناموجود Acros
15 آب اکسیژنه 2.5lit ناموجود Merck
16 لوله فالکون 15 بسته 25عددي استريل Biofil 25 pcs ناموجود Jetbiofil
17 بنزن-امينسان None ناموجود ایرانی
18 استريپ 0.2 (8تايي) None ناموجود چینی
19 tris ايراني None ناموجود ایرانی
20 DMSO 2.5 lit Applichem None ناموجود Applichem
21 TSH 96 Test Elisa Aminsan None ناموجود None
22 بشر 600 سي سي None ناموجود None
23 بشر1000 سي سي None ناموجود None
24 ترازو دوکفه اي 200گرم None ناموجود None
25 ايميدازول 100gr Acros None ناموجود Acros
26 پليت 6 خانه کشت سلول استريل plate ناموجود None
27 پي پت پاستور شيشه اي بلند 250عددي None ناموجود None
28 رک کرايوتيوب 1.8 Pack ناموجود چینی
29 Buffer Taq*10 None ناموجود TaKaRa
30 Buffer MgSo4 None ناموجود TaKaRa
31 کلريد سديم-امينسان ناموجود ایرانی
32 Loading biffer-ايراني None ناموجود ایرانی
33 سرسمپلر آبي Dnase Rnase Free None ناموجود None
34 پليت 48 خانه استريل plate ناموجود None
35 Iso Propanol 2.5lit ناموجود Applichem
36 Agarose-100gr-Acros - None ناموجود Acros
37 لوپ - pack ناموجود ایرانی
38 DNase I Solution (1 mg/mL) 0-7900 1ml ناموجود StemCell
39 Buffer K 1000 1ml ناموجود TaKaRa
40 Buffer PCR 1000 1ml ناموجود TaKaRa
41 Buffer M 1000 1ml ناموجود TaKaRa
42 Buffer H 1000 Vial ناموجود TaKaRa
43 Buffer Triton X100 1000 1ml ناموجود TaKaRa
44 Buffer L 1000 1ml ناموجود TaKaRa
45 Acetonitrile 100030 2/5L ناموجود Merck
46 Rolipram 10MG 10011132-10mg None ناموجود Cayman
47 Acc I 1001A 100U ناموجود TaKaRa
48 Zirconium chloride 10026-11-6 25 GR ناموجود Acros
49 Acc II 1002A 100 unit ناموجود None
50 Hcl Merck 2.5 lit 100317 None ناموجود Merck
51 Ethanol 100971 2.5lit ناموجود Merck
52 Ethanol 2.5lit Merck 100983 ناموجود Merck
53 BamH I 1010A 10000 U ناموجود TaKaRa
54 Ammonium persulfate [APS] 101200 1KG ناموجود Merck
55 Ban II 1012A 2000u ناموجود TaKaRa
56 Bcn I (Cau II ‘NCi1) 1019A 1,000 U ناموجود TaKaRa
57 Bgl II 1021A 2000 ناموجود TaKaRa
58 Bln I (Avr II) 1022A 400 Units ناموجود TaKaRa
59 Bsp1286 I (Sdu I) 1024A 500 Units ناموجود TaKaRa
60 4th WHO International Standard for HBV DNA for NAT 10/266 None ناموجود NIBSC
61 FBS 10270-106 500ml ناموجود Gibco
62 Dimethyl Yellow 103055-10g None ناموجود Sigma
63 Restriction Enzyme Cpo l 1035A ناموجود TaKaRa
64 EcoT14I (StyI) 1038A 3,000 Units ناموجود TaKaRa
65 EcoR I 1040A 10000 U ناموجود TaKaRa
66 EcoR V 1042A 3000u ناموجود TaKaRa
67 Restriction Enzyme EcoO109 l 1043A ناموجود TaKaRa
68 Fba I (Bcl I) 1045A 500units ناموجود TaKaRa
69 Fok I 1046A 1,000 Units ناموجود TaKaRa
70 L-Arabinose 25gr 10498 Acros ناموجود BioBasic
71 Hae III 1051A 4000Units ناموجود TaKaRa
72 1,1,1,3,3,3-Hexafluoro-2-propanol 105228-5G None ناموجود Sigma
73 Hae II 1052A 1000unit ناموجود TaKaRa
74 Hap II (Hpa II, Msp I) 1053A 2,000 Units ناموجود TaKaRa
75 آمونیاک 105426 2.5lit ناموجود Merck
76 Hha I 1056A 2,000 Units ناموجود TaKaRa
77 HincII (HindII) 1059A 1,000 Units ناموجود TaKaRa
78 Methanol Merck 2.5 lit 106007 None ناموجود Merck
79 Methanol 106008 2.5lit ناموجود Merck
80 Methanol 106018 2.5lit ناموجود Merck
81 دی کلرو متان 106050 2.5lit ناموجود Merck
82 Hind III 1060A 10000 U ناموجود TaKaRa
83 HpaI 1064A 500 Units ناموجود TaKaRa
84 Kpn I 1068A 5000u ناموجود TaKaRa
85 Mfl I (Xho II) 1070A 500 Units ناموجود TaKaRa
86 PstI 1073A 10,000 Units ناموجود TaKaRa
87 Sac I 1078A 2000 U ناموجود TaKaRa
88 Sac II 1000u 1079A 1000u ناموجود TaKaRa
89 Sal I 1080A 3,000 Units ناموجود TaKaRa
90 Sau3AI (MboI) 1082A 200 Units ناموجود TaKaRa
91 Histopaque(ficoll) 10831 100ml ناموجود Sigma
92 Sma I 1085A 2000u ناموجود TaKaRa
93 گزیلول 108681 2.5lit ناموجود Merck
94 Spe I 1086A 300 units ناموجود TaKaRa
95 Xba I 1093A 3,000 Units ناموجود TaKaRa
96 Xho I 1094A 5000U ناموجود TaKaRa
97 Xsp I (Bfa I, Mae I) 1095A 500 Units ناموجود TaKaRa
98 2پروپانول Merck 2.5 lit 109634 None ناموجود Sigma
99 Afa I (Rsa I ) 1000 units 1116A 1000U ناموجود TaKaRa
100 Eae I (Cfr I) 1123A 200 Units ناموجود TaKaRa
101 EcoO65I (BstEII, BstPI) 1135A 1,000 Units ناموجود TaKaRa
102 Sodium Pyrivate MEM 11360039 None ناموجود Invitrogen
103 Mbo II 1145A 400Units ناموجود TaKaRa
104 Msp I (Hpa II) 1150A 3,000 Units ناموجود TaKaRa
105 Water HPLC grade 115333 2.5lit ناموجود Merck
106 Skim milk powder 115363 500g ناموجود Merck
107 Nae I 1155A 500Unit ناموجود TaKaRa
108 Nco l 1160A 500Unit ناموجود TaKaRa
109 Nde I 1161A 400u ناموجود TaKaRa
110 LIFE TECHNOLOGIES LIPOFECTAMINE REAGENT 0.3ML 11668-030 None ناموجود None
111 DNA Molecular Weight Marker VII. DIG-labeled 11669940910 None ناموجود Roche
112 Not I 1166A 500 U ناموجود TaKaRa
113 2.4 dinitrophenyl hydrazin* 11706 None ناموجود Sigma
114 Taq I 1189A 2000u ناموجود TaKaRa
115 VpaK11B I (Ava II) 1196A 300 Units ناموجود TaKaRa
116 Dpn I (Mal I) 1235A 1,000 Units ناموجود TaKaRa
117 Hinf I 1238A 6000U ناموجود TaKaRa
118 Nhe I 1241A 700U ناموجود TaKaRa
119 Pvu II 1243A 4,000 Units ناموجود TaKaRa
120 SphI 1246A 600u ناموجود TaKaRa
121 pOptiVEC™-TOPO® TA Cloning® Kit 12744-017 kit ناموجود Invitrogen
122 Vindoline 13940871-10MG 10mg ناموجود Molekula
123 Vindoline 13940871-1MG None ناموجود Molekula
124 Hepatitis C virus (HCV) For nucleic acid amplification techniques (5th International standard 2015) 14/150 None ناموجود NIBSC
125 Non WHO Reference Material 4th HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques 14/290 None ناموجود NIBSC
126 Pen/Strep 20 ml Invitrogen 15140148 None ناموجود Invitrogen
127 Calsemid Invitrogen 10ml 15210-057 None ناموجود Invitrogen
128 15547 100 mg 15547 None ناموجود Cayman
129 ReadyStrip™ IPG Strips* 1632007 None ناموجود Biorad
130 ReadyStrip™ IPG Strips 1632008 None ناموجود None
131 100x BioLyte® 3/10 Ampholyte 1632094 1pack ناموجود Biorad
132 Guanidine hydrochloride, biotech* 17577-25g None ناموجود Acros
133 آلژنیک اسید 180947 100gr ناموجود Sigma
134 UREA pearls 98% 1KG 197460010 Acros ناموجود BioBasic
135 Urea-500g- Acros 19746-500g None ناموجود Acros
136 in vivo jetPEI Transfection Reagent (glucose inclus) 201-10G None ناموجود Poly Plus
137 T4 DNA Ligase 2011A 25000u ناموجود TaKaRa
138 Pro measure protein measurement solution 21011 None ناموجود Intron
139 DNA Polymerase I(E.coli) 2130A 500 Units ناموجود TaKaRa
140 Klenow Fragment 2140A 200unit ناموجود TaKaRa
141 Imidazole 21611083 500g ناموجود Molekula
142 Poly(A) Polymerase 2180A 20 Units ناموجود TaKaRa
143 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
144 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
145 Recombinant DNase I ,(RNase free) 2270A 1000u ناموجود TaKaRa
146 pvp 227545 100gr ناموجود Acros
147 Apigenin 22930039-1G ناموجود Molekula
148 SDS Acros 100g 23042 100g ناموجود Acros
149 Recombinant RNase Inhibitor 2313A 5000u ناموجود TaKaRa
150 Recombinant RNase Inhibitor 2313Q 500U ناموجود TaKaRa
151 1-Chloro-2,4-dinitrobenzene 237329 10g ناموجود Sigma
152 T7 RNA Polymerase 5000U 2540A 5000 U ناموجود TaKaRa
153 Grassofermata 1MG 26202-1mg None ناموجود Cayman
154 Exonuclease I 2650A 750 Units ناموجود TaKaRa
155 PrimeScript™ Reverse Transcriptase 2680A 10000u ناموجود TaKaRa
156 PrimeScript™ Reverse Transcriptase 2680Q 2000u ناموجود TaKaRa
157 Trichloroacetic acid 27071914-1KG 1kg ناموجود Molekula
158 Methacrylic anhydride 276685-500ML None ناموجود Sigma
159 DMEM/F-12, GlutaMAX™ supplement 31331-028 500ml ناموجود Invitrogen
160 Dextran from Leuconostoc spp.* 31390-25G None ناموجود Sigma
161 DMEM, powder, low glucose, pyruvate 31600-034 1lit ناموجود Invitrogen
162 DMEM powder 10 lit Low glucose 31600-083 10lit ناموجود Invitrogen
163 Thiometon in Shellsol 31681-250MG None ناموجود Sigma
164 Temozolomide 31724662-1G 1g ناموجود Molekula
165 RPMI 1640 Powder 1lit Invitrogen 31800-014 1lit ناموجود Invitrogen
166 Bifenazate 32504-50MG None ناموجود Sigma
167 Flonicamid 32509-25MG None ناموجود Sigma
168 pRl201-AN DNA 3264 ناموجود TaKaRa
169 T-Vector pMD20 3270 1 ug ناموجود TaKaRa
170 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-100G 100g ناموجود Molekula
171 Maltose, monohydrate 329915000-500g None ناموجود Acros
172 (+)-Usnic acid 329967-5G None ناموجود Sigma
173 Acetic Acid 33209 2.5lit ناموجود Sigma
174 Chaperone Plasmid Set 3340 1 Set ناموجود TaKaRa
175 pCold DNA Cold Shock Expression System 3360 1 Set ناموجود TaKaRa
176 Ytterbium(III) chloride hexahydrate 337927-10G None ناموجود Sigma
177 200 bp DNA ladder 3410A 50 µg ناموجود TaKaRa
178 500 bp DNA ladder 3411A 50 µg ناموجود TaKaRa
179 Wide-range DNA ladder 0.8ml TaKaRa 3415A ناموجود TaKaRa
180 Parathion-methyl 36187-100MG None ناموجود Sigma
181 Sodium tetraborate decahydrate 367207 1Kg ناموجود Carlo
182 CellAmp™ Direct RNA Prep Kit for RT-PCR (Real Time) 3732 200 Rxns ناموجود TaKaRa
183 CellAmp™ RT-PCR for Direct Prep Kit (Real Time) & Protein Analysis 3733Q 25 preps ناموجود TaKaRa
184 Laccase  from  Trametes  versicolor 38429-1G None ناموجود Sigma
185 Propidium Iodide (PI) 40016 None ناموجود Biotium
186 dATP 4026 100 umol ناموجود TaKaRa
187 dGTP 4027 100 umol ناموجود TaKaRa
188 dCTP 4028 100 umol ناموجود TaKaRa
189 dTTP 4029 100 umol ناموجود TaKaRa
190 dNTP Mixture 180 ul 4030 180ul ناموجود TaKaRa
191 dNTP mixture 4030 1.28 ml ناموجود TaKaRa
192 Gel Red 41003 0.5ml ناموجود Biotium
193 2-Hydroxy-4?-(2-hydroxyethoxy)-2-methylpropiophenone 410896-10G None ناموجود Sigma
194 Paraformaldehyde 416782500 100gr ناموجود Acros
195 (+)-cat_numberechin 43412 10MG ناموجود Sigma
196 Thulium(III) chloride 439649-1G None ناموجود Sigma
197 Dinocap 45452-100MG None ناموجود Sigma
198 Carbazole 46100-250MG-R None ناموجود Sigma
199 Aspartame 47135 500mg ناموجود Sigma
200 ProClin™ 300 48914-U None ناموجود Sigma
201 Curcumin 49256996-25G 25g ناموجود Molekula
202 Curcumin 49256996-5g 5g ناموجود Molekula
203 لوله فالکون 15 استريل RNase & DNase Free بسته 50عددي 50015 None ناموجود SPL
204 RPMI 1640 Powder 1 lit Invitrogen 51800-019 1lit ناموجود Invitrogen
205 RPMI 1640 Powder 10lit Invitrogen 51800-035 10lit ناموجود Invitrogen
206 Resveratrol 51852282-1G 1g ناموجود Molekula
207 Tannic acid 52612564-1KG 1Kg ناموجود Molekula
208 DNA Ligation Kit, Mighty Mix 6023 100 Rxns ناموجود TaKaRa
209 DNA Ligation Kit Mighty Mix (20 react) 6023Q ناموجود TaKaRa
210 cDNA synthesis kit: PrimeScript First Strand cDNA Synthesis Kit 6110A 50 Rxns ناموجود TaKaRa
211 3'-Full RACE Core Set 6121 20 react ناموجود TaKaRa
212 3'-Full RACE Core Set 6122 10 react ناموجود TaKaRa
213 PrimeScript II 1st strand cDNA synthesis kit 6210A Kit ناموجود TaKaRa
214 Lenti-X™ qRT-PCR Titration Kit 200 Rnx Clontech 631235 1kit ناموجود TaKaRa
215 Xfect Transfection Reagent 631316 None ناموجود TaKaRa
216 N-Ethylmaleimide 63480 None ناموجود Sigma
217 Real Time qPCR Master Mix - Terra qPCR Direct SYBR Premix 638319 ناموجود TaKaRa
218 1-Ethyl-3-methylimidazolium L-(+)-lactate 669512 5G ناموجود Sigma
219 فلاسک کشت سلول 25cm فيلتردار استريل بسته5 عددي 70025 None ناموجود SPL
220 فلاسک کشت سلول 75cm فيلتردار استريل بسته5 عددي 70075 None ناموجود SPL
221 Skim Milk Powder 70166-500G 500G ناموجود Sigma
222 HRV 3C Protease 500U 7360 None ناموجود TaKaRa
223 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-10G ناموجود Molekula
224 Acrylamide 800830 1kg ناموجود Merck
225 4-CHLOROPHENOL 802254 100gr ناموجود Merck
226 2.7-Dichlorodihydrofluorescein diacetate 85155-50MG None ناموجود Cayman
227 cat_numberharanthine 89985253-10MG 10mg ناموجود Molekula
228 Catharanthine 89985253-1MG None ناموجود Molekula
229 Hydroxyapatite 900193-50G None ناموجود Sigma
230 RNase-Free Water 9012 1ml ناموجود TaKaRa
231 RNase -Free Water-1ML 9012-1ML 1ML ناموجود TaKaRa
232 IPTG 9030 5gr ناموجود TaKaRa
233 X-Gal 9031 1gr ناموجود TaKaRa
234 DNA OFF 9036 500ml ناموجود TaKaRa
235 RNase - OFF 500 ml 9037 500ml ناموجود TaKaRa
236 E. coli HB101 Competent Cells 9051 Set ناموجود TaKaRa
237 GC Buffer I 9154 1.25ml ناموجود TaKaRa
238 Loading buffer 10 X 9157 vials ناموجود TaKaRa
239 Alcian blue 8GX A0298 5gr ناموجود BioBasic
240 Potassium hydroxide A0566 1kg ناموجود Applichem
241 Albumin EIA and RIA grad A0850 500g ناموجود Applichem
242 Albumin A0850,0500 None ناموجود Applichem
243 8-Anilino-1-naphthalenesulfonic  acid A1028-5G None ناموجود Sigma
244 Amyloid beta Protein Fragment 1-40 A1075-.1MG None ناموجود Sigma
245 Calcium Chloride dried, powdered pure A1428-0500 ناموجود Applichem
246 Streptavidin ultrapure A1495 1mg ناموجود None
247 Streptavidin ultrapure A1495 1gr ناموجود Applichem
248 Acetyl coenzyme A sodium salt A2056 1MG ناموجود Sigma
249 5-Azacytidine A2385 100MG ناموجود None
250 Amphotericin B solution A2942 100ml ناموجود Sigma
251 Peroxidase HRP A3615 None ناموجود Applichem
252 Acridine orange hemi salt A742007 10G ناموجود BioBasic
253 Acridine orange hemi salt A742007-5G None ناموجود BioBasic
254 Anti-Human IgG−Peroxidase antibody produced in rabbit A8792 2ml ناموجود Sigma
255 Amberlite™ IRN-77, ion exchange resin, Nuclear grade, Alfa Aesar™ AA1682136 - Alfa Aesar™ None ناموجود AlfaAesar
256 Acetylcholine chloride AB0002 25gr ناموجود BioBasic
257 Agarose M AB0013 250gr ناموجود BioBasic
258 Agarose B, low EEO AB0014 250gr ناموجود BioBasic
259 Agarose, Low melting gel AB0015 10gr ناموجود BioBasic
260 Agarose, Low melting gel.SIZE.25G AB0015-25G 25G ناموجود BioBasic
261 L-Asparagine monohydrate AB0017 100g ناموجود BioBasic
262 L-Ascorbic acid ( Vitamin C) AB0021 100G ناموجود BioBasic
263 Ampicillin, sodium salt USP AB0028 25gr ناموجود BioBasic
264 Ampicillin,sodium salt USP 5gr Ab0028-5g None ناموجود BioBasic
265 Nitrilotriacetic acid AB0055 100gr ناموجود BioBasic
266 Ampicillin, trihydrate AB0064 25G ناموجود BioBasic
267 Ammonium persulfate [APS] AB0072 25G ناموجود BioBasic
268 L-Arginine free base AB0205-10G 10g ناموجود BioBasic
269 L-Arginine free base AB0205-25G 25g ناموجود BioBasic
270 L-Arginine AB0205.SIZE.500G None ناموجود BioBasic
271 Normal Goat Serum Ab156046 None ناموجود َAbcam
272  N-Acetyl-L-Cysteine AB6697 25gr ناموجود BioBasic
273 Goat  Anti-Rabbit  IgG  H&L  (HRP) AB97069 ناموجود Sigma
274 ACES AD0004 500gr ناموجود BioBasic
275 ACES AD0004-500G 500G ناموجود BioBasic
276 Adenosine AD0016 25G ناموجود BioBasic
277 Adenosine AD0016 5gr ناموجود BioBasic
278 Albumin, heat shock isolation pH 7.0 AD0023 25gr ناموجود BioBasic
279 Amido black 10B AD0027 5gr ناموجود BioBasic
280 Amphotericin B AD0030P 5g ناموجود BioBasic
281 Avidin AD0068 5MG ناموجود BioBasic
282 Alizarin red S AD0144 25gr ناموجود BioBasic
283 Mupid One Submarine AD160 دستگاه ناموجود TaKaRa
284 Ammonium sulfate ADB0060 500gr ناموجود BioBasic
285 ترازو دقیق دیجیتالی (دقت یک صدم، ظرفیت 4000 گرم AGZ4000C دستگاه ناموجود None
286 TACCAAGAGAACTACATATCCGATGACCTTCCGTGGGGCCTAGTAGTTGCGGGACTACTAGACACTGTATGA apte zia-72bp None ناموجود BioBasic
287 Albumin, Protease Free AR2449 50gr ناموجود BioBasic
288 Rapid animal G-DNA AT4780 10prep ناموجود BioBasic
289 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 320 گرم) ATA320 دستگاه ناموجود None
290 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 520 گرم) ATA520 دستگاه ناموجود None
291 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 320 گرم) ATZ320 دستگاه ناموجود None
292 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 520 گرم) ATZ520 دستگاه ناموجود None
293 Alkaline phosphatase Power AP AZ140A 1mg ناموجود BioBasic
294 Taq DNA Polymerase, 5U/UL B0089 200u ناموجود BioBasic
295 Taq DNA Polymerase, 5U/UL B0089(D0089) 1000u ناموجود BioBasic
296 TAQ DNA POLYMERASE, 5U/UL.SIZE.500U B0089(D0089)-500U None ناموجود BioBasic
297 bisBenzimide H 33258 B2883-25MG None ناموجود Sigma
298 Boric acid BB0044 500gr ناموجود BioBasic
299 D-Biotin .SIZE.5G BB0078-5gr 5G ناموجود BioBasic
300 X-Gal BB0083 1gr ناموجود BioBasic
301 X-GLUC (X-GlcA) BB0085 25MG ناموجود BioBasic
302 Bacitracin zinc BB0113 25G ناموجود BioBasic
303 Bile salt BB0225-25G 25g ناموجود BioBasic
304 RNase H, 10U/UL BEN0202 500u ناموجود BioBasic
305 RNase I, 10U/UL BEN0601 1 Ku ناموجود BioBasic
306 10-175kDa Wide Range Protein Molecular Weight Marker, Prestained11 band: 10, 15, 20, 30, 40, 50, 60, 70, 95, 120, 175kDa BG00363 500ul ناموجود BioBasic
307 10-240kDa Wide Range 3 Color Prestained Protein Ladder BG00364 500UL ناموجود BioBasic
308 Low Range Protein Molecular Weight Marker BM201 30ul ناموجود BioBasic
309 Protein Marker, Mid Range, ready to use BM523 200ul (20 loadings) ناموجود BioBasic
310 14.4-98kDa Mid Range Protein Molecular Weight Marker BM524 200ul ناموجود BioBasic
311 0.2ML PCR TUBE, FLAT CAP BP541-S100 0.2ML ناموجود BioBasic
312 تیوب 5/0 میلی لیتر مخصوص PCRبدون رنگ با درب تخت دارای بسته بندی 1000تایی Rnase/DNase Free BP602-S100 بسته ناموجود BioBasic
313 تیوب 5/0 میلی لیتر مخصوص PCRبدون رنگ با درب تخت دارای بسته بندی 100تایی Rnase/DNase Free BP602-S100-1pak 100pcs ناموجود BioBasic
314 EZ-10 Cleanup Minipreps Kit BS367 50 PREPS ناموجود BioBasic
315 EZ-RNA Reagents (Trizol) BS409A 25ML ناموجود BioBasic
316 EZ-RNA Reagents 10ml BS409A-10ML None ناموجود BioBasic
317 EZ-RNA Reagents (Trizol) BS410A 100ml ناموجود BioBasic
318 EZ-10Spin Column Bacterial DNA Mini Preps Kit 50pr BS423-50 preps 50 preps ناموجود BioBasic
319 Fast DNA Ligation Kit(5u/ul.T4) BS512-50 Rxn None ناموجود BioBasic
320 EZ-10 Spin Column Total RNA Mini-Preps Super Kit BS584 100preps ناموجود BioBasic
321 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS614 250 preps ناموجود BioBasic
322 EZ-10 Spin Column DNA Gel Extraction Kit BS654 250 preps ناموجود BioBasic
323 One-Tube Tissue DNA Extraction Kit BS8401 100 preps ناموجود BioBasic
324 One-Tube Clinical Sample DNA Extraction Kit.SIZE.100 Preps BS8403-100prep None ناموجود BioBasic
325 One-Tube Bacteria DNA Isolation Kit BS8413 100 PREPS ناموجود BioBasic
326 RNase-Free DNase Set BS88253-50 preps None ناموجود BioBasic
327 EZ-10 Spin Column Fungal RNA Mini-Preps Kit BS91915 50 PREPS ناموجود BioBasic
328 14.4-116kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0431 1ml ناموجود BioBasic
329 14.4-116kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0431 2x1ml ناموجود BioBasic
330 20-120kDa Mid Range Protein Molecular Weight Marker, Prestained BSM0441 250UL ناموجود BioBasic
331 20-120kDa Mid Range Protein Molecular Weight Marker, Prestained BSM0441-250UL ناموجود BioBasic
332 10-200kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0661 2x250ul ناموجود BioBasic
333 10-200kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0661-250ul 250ul ناموجود BioBasic
334 10-170kDa Wide Range Protein Molecular Weight Marker, Prestained BSM0671 2x250ul ناموجود BioBasic
335 10-170kDa Wide Range Protein Molecular Weight Marker, Prestained BSM0671-250ul 250ul ناموجود BioBasic
336 Total Protein Extraction Kit BSP003 50preps ناموجود BioBasic
337 0.1-10ul Micro Tips, Short,1000/Pack,Sterile BT215 1000Pack ناموجود BioBasic
338 سرسمپلرکریستالی کوتاه (10-0.1 میکرو لیتر) استریل Rnase/DNase Free بسته هزار عددی BT215-S بسته هزار عددی ناموجود BioBasic
339 سر سمپلر آبی (1000-100میکرولیتر) استریل بدون Rnase/DNase Free رنگ بسته هزار عددی BT222-NS بسته هزار عددی ناموجود BioBasic
340 سر سمپلر زرد (200 میکرو لیتر) مدرج استریل بدون رنگ بسته هزار عددی Rnase/DNase Free BT224-NS بسته ناموجود BioBasic
341 رک سر سمپلر زرد (200 میکرو لیتر) مدرج استریل Rnase/DNase Free بدون رنگ BT224-RS Rack ناموجود BioBasic
342 سرسمپلر 300میکرولیتر، استریل  Rnase/DNase Free BT330-NS 1000 pcs ناموجود BioBasic
343 Rapid Blood RNA Isolation Kit BT4182 10preps ناموجود BioBasic
344 Rapid Blood DNA Extraction Kit BT4782 50preps ناموجود BioBasic
345 فالکون 15 BT888-SN بسته 100 تایی ناموجود BioBasic
346 15ML Centrifuge Tube, Screw Cap, Red, Sterile, 100/Bag BT888-SR SR ناموجود BioBasic
347 15ML Centrifuge Tube, Screw Cap, Yellow, Sterile, 100/Bag BT888-YS 100pcs ناموجود BioBasic
348 ترازو دقیق دیجیتالی (دقت یک صدم، ظرفیت 2100 گرم BTA2100D دستگاه ناموجود None
349 ترازو دقیق دیجیتالی (دقت یک هزارم، ظرفیت 210 گرم BTA210D دستگاه ناموجود None
350 (−)-cat_numberechin C0567 5MG ناموجود Sigma
351 (±)-cat_numberechin hydrate C1788 500MG ناموجود Sigma
352 Cesium chloride         C3032 25gr ناموجود Sigma
353 Acetylcholinesterase from Electrophorus electricus (electric eel) C3389 2KU ناموجود Sigma
354 Acetylcholinesterase from Electrophorus electricus (electric C3389-500U ناموجود None
355 Water C8801 500ml ناموجود BioBasic
356 Cyanogen bromide-activated-Sepharose® 4B 1g Sigma C9142 None ناموجود Sigma
357 Calcium nitrate tetrahydrate, extra pure Ca(NO3)2·4H2O CA0230 1kg ناموجود Scharlau
358 Coomassie brilliant blue R-250    CB0037 25gr ناموجود BioBasic
359 Citric acid CB0055 1Kg ناموجود BioBasic
360 L-Cysteine CB0088-500g None ناموجود BioBasic
361 CTAB CB0108 100g ناموجود BioBasic
362 L-Cysteine CB0132 100gr ناموجود BioBasic
363 CELLBANKER 1plus CB022  20ml ناموجود TaKaRa
364 Calcium phosphate, tribasic CB0263 250gr ناموجود BioBasic
365 CELLBANKER 2 CB032  20ml ناموجود TaKaRa
366 Curcumin CB0346 5gr ناموجود BioBasic
367 Cytochrome C CB0354-100MG 100G ناموجود BioBasic
368 STEM-CELLBANKER CB042  20ml ناموجود TaKaRa
369 STEM-CELLBANKER CB044S  4ml ناموجود TaKaRa
370 STEM-CELLBANKER GMP grade CB047 4*20 ml ناموجود TaKaRa
371 Chlorocholine chloride CB0736 5G ناموجود BioBasic
372 Cresol red, free acid CD0037B 5gr ناموجود BioBasic
373 Calcium chloride, dihydrate CD0050-2.5kg 2.5kg ناموجود BioBasic
374 Cholesterol CD0122 50gr ناموجود BioBasic
375 Cytosine CD0138 10gr ناموجود BioBasic
376 Copper (II) sulfate pentahydrate CDB0063-400g ناموجود BioBasic
377 Carbenicillin disodium CDJ469.SIZE.5G None ناموجود BioBasic
378 CASEIN CN5204 500gr ناموجود BioBasic
379 تیوب ml50با درب بدون رنگ مخصوص سرعت بالا، استریل/بسته 25تایی  Rnase/DNase Free CT790-SN 25pcs ناموجود BioBasic
380 Agarose A D0012-250gr 250gr ناموجود BioBasic
381 Albumin,pH 5.1+0. D0024 50gr ناموجود BioBasic
382 Albumin,pH 5.1+0.2 10gr D0024-10G 10G ناموجود BioBasic
383 Albumin,pH 5.1+0.2 25gr D0024-25G 25G ناموجود BioBasic
384 Albumin, pH 5.1+0.2 5gr D0024-5G 5G ناموجود BioBasic
385 2'-Deoxythymidine-5'-triphosphate 100mM solution[dTTP], sodium salt D0046T 0-5ml ناموجود BioBasic
386 TSG DNA POLYMERASE, 5U/UL.SIZE. 200 u D0081-200u None ناموجود BioBasic
387 Dialysis tubing cellulose membrane23mm غشاء دیالیز با قطر 23mm (Molecular weight cut-off : 12400Da) D0405 1meter ناموجود Sigma
388 Dialysis tubing cellulose membrane32mm غشاء دیالیز با قطر 32mm (Molecular weight cut-off : 12400Da) D0530 1meter ناموجود Sigma
389 1,4-Diaminobutane D13208 100gr ناموجود Sigma
390 Diphenyl phosphite D210803 100gr ناموجود Sigma
391 Dimethyl sulfoxide (DMSO) Cell Culture Grade D2650-10ML 10ml ناموجود Sigma
392 Dansyl chloride D705183 1G ناموجود BioBasic
393 Dialysis tubing cellulose membrane10mm غشاء دیالیز با قطر 10mm (Molecular weight cut-off : 14KDa) D9277 1meter ناموجود None
394 Dialysis tubing cellulose membrane43mm غشاء دیالیز با قطر 43mm (Molecular weight cut-off : 14KDa) D9527 1meter ناموجود Sigma
395 DTNB, 5,5'-Dithiobis-(2-nitrobenzoic acid) DB0113-1g None ناموجود BioBasic
396 DAB, tetra hydrochloride DB0140 5gr ناموجود BioBasic
397 DAB, tetra hydrochloride DB0140 25gr ناموجود BioBasic
398 Dextran sulfate DB0160 10g ناموجود BioBasic
399 Sodium chloride DB0483 2.5kg ناموجود BioBasic
400 Doxycycline, hydrochloride DB0889 25gr ناموجود BioBasic
401 Deoxycholic acid, sodium salt DD0150 50G ناموجود BioBasic
402 DEPC Water DD1005 500ml ناموجود BioBasic
403 DNAfectamine DNAF001-0.1ML None ناموجود BioBasic
404 Eco-Stain . ready to use DT81413-1 ML 1ML ناموجود BioBasic
405 Benzonase® Nuclease E1014 25ku ناموجود Sigma
406 Benzonase® Nuclease E1014 5ku ناموجود Sigma
407 Elastase from human leukocytes E8140-1UN None ناموجود Sigma
408 EDTA , disodium salt , dihydrate EB0185 500gr ناموجود BioBasic
409 EDTA, disodium salt, dihydrateSIZE.100G EB0185-100G 100g ناموجود BioBasic
410 Ethidium bromide (EB; EtBr) EB0195 1gr ناموجود BioBasic
411 EDAC, hydrochloride EB0433 25g ناموجود BioBasic
412 EDAC, hydrochloride.SIZE.5G EB0433-5G 5g ناموجود BioBasic
413 Ethyl acetate Reagent EC4600 1lit ناموجود BioBasic
414 Ethylene glycol ED0199 250ml ناموجود BioBasic
415 Alu I ER0011 600U ناموجود Thermo
416 Thermo Scientific™ PstI (10 U/µL) ER0611 None ناموجود Thermo
417 MnlI ER1071 None ناموجود Thermo
418 Fluorescein  diacetate F7378-10G None ناموجود None
419 Agar A FB0010-100G 100gr ناموجود BioBasic
420 Formamide deionized FB0211-500ml None ناموجود BioBasic
421 Fast Green FCF FB0452 5gr ناموجود BioBasic
422 Iron (III) sulfate, hydrate FD0208 250gr ناموجود BioBasic
423 Thermo Scientific™ FastDigest™ Bsp1407I FD0933 None ناموجود Thermo
424 Formamide FDB0212 500ml ناموجود BioBasic
425 Formononetin 100 mg FF09317-100mg None ناموجود Carbosynth
426 Sorafenib tosylate 500 mg FS10808 None ناموجود Carbosynth
427 رک سرسمپلرفیلتردار10-1/0 میکرو لیتراستریل رک 96 عددی  Rnase/DNase Free FT215-RNS رک 96 عددی ناموجود BioBasic
428 سرسمپلر فیلتردار شفاف –سایز 1000-100میکرولیتر بسته 1000 عددی FT222 1000pcs ناموجود BioBasic
429 سرسمپلرفیلتردار100-10  میکرو لیتر بسته 1000 عددی FT224 1000pcs ناموجود BioBasic
430 10-100UL Filter Tip, Natural, Sterile, 96/Rack FT224-RNS رک 96 عددی ناموجود BioBasic
431 0.5-10UL FILTER TIP, NATURAL,1000/PACK FT225 ناموجود BioBasic
432 Gluglutaraldehyde G0875 25ml ناموجود BioBasic
433 Agar C G1253 500G ناموجود BioBasic
434 Peptone B SOY Protein G214 500G ناموجود BioBasic
435 Peptone B SOY Protein G214-100G 100G ناموجود BioBasic
436 Peptone F Lactalbumin Hydrolysate G256 500G ناموجود BioBasic
437 Guanidine Oxidized* G4375-1g None ناموجود Sigma
438 Gelatin from bovine skin G9382-1KG None ناموجود Sigma
439 Gelatin G9764 100gr ناموجود BioBasic
440 Gelatin.SIZE.50G G9764-50G 50g ناموجود BioBasic
441 D(+)Galactose GB0215 25gr ناموجود BioBasic
442 D-Glucose, monohydrate GB0218 500gr ناموجود BioBasic
443 D-Glucose, anhydrous Gb0219 1KG ناموجود BioBasic
444 Glutathione oxidized GB0228 1g ناموجود BioBasic
445 Glutathione reduced GB0229 1gr ناموجود BioBasic
446 Glutathione reduced GB0229 5gr ناموجود BioBasic
447 Glycerol GB0232 500ml ناموجود BioBasic
448 glycine GB0235 2.5K ناموجود BioBasic
449 Guanidine hydrochloride, biotech GB0242 100gr ناموجود BioBasic
450 Guanidine hydrochloride, biotech GB0242 500G ناموجود BioBasic
451 Guanidine hydrochloride, reagent GB0243 500G ناموجود BioBasic
452 Guanidine thiocyanate, biotech GB0244 250G ناموجود BioBasic
453 Guanidine thiocyanate, biotech GB0244 1KG ناموجود BioBasic
454 Glycogen GB0301 1gr ناموجود BioBasic
455 G 418 sulfate GDJ958 1gr ناموجود BioBasic
456 Guanidine thiocyanate, ultra pure.SIZE.250G GDR0244 None ناموجود None
457 Guanidine thiocyanate, ultra pure.SIZE.1KG GDR0244 1KG ناموجود BioBasic
458 Amersham™ Hybond® P Western blotting membranes, PVDF GE10600021 1ea ناموجود Sigma
459 DEAE Sepharose® Fast Flow GE17-0709-10 25ml ناموجود GE Health Care
460 Percoll® PLUS GE17-5445-02 None ناموجود GE Health Care
461 Gene synthesis 336bp Gene Synthesis AMINO073 None ناموجود BioBasic
462 Low MW DNA Marker A ready touse25,50,75,100,150,200,300,400,500bp GM303 20 loading ناموجود BioBasic
463 25-500bp Low Range DNA Marker A, Ready-to-use GM303-20 loading None ناموجود BioBasic
464 DNA Marker B, Ready-to-use 100-600bp Low Range DNA Marker B, Ready-to-Use 6 DNA fragments: 100, 200, 300, 400, 500, 600bp GM331 50 Loading ناموجود BioBasic
465 دسته هاون خردکننده بافت، مخروطی شکل GR111 100 loading ناموجود BioBasic
466 Adenovirus Fiber monomer and trimer antibody [4D2] GTX23233 None ناموجود Genetex
467 CASP3 (Human) Recombinant Protein (P01) H00000836 P01-10ug ناموجود Abnova
468 IFNB1 purified MaxPab rabbit polyclonal antibody (D01P) H00003456 D01P-100ug ناموجود BioBasic
469 TRAF6 monoclonal antibody (M02), clone 1B2 H00007189 M02-50ug ناموجود Abnova
470 IL1R2 monoclonal antibody (M01), clone 1G12 H00007850 M01-100ug ناموجود Abnova
471 Hanks , Balanced Salts,Powder H2387 1lit ناموجود Sigma
472 6-Hydroxydopamine hydrochloride H4381 100mg ناموجود Sigma
473 Oligo synthesis HAP Purification OD2 H510001-0002 None ناموجود BioBasic
474 HEPES free acid SiZE.25gr HB0264 ناموجود BioBasic
475 HEPES, sodium salt HB0265 1KG ناموجود BioBasic
476 Histamine dihydrochloride HB0501 5gr ناموجود BioBasic
477 N-Hydroxysuccinimide HB0526 25G ناموجود BioBasic
478 N-Hydroxysuccinimide HB0526-10g 10g ناموجود BioBasic
479 N-Hydroxysuccinimide HB0526-20g ناموجود BioBasic
480 HCL -500ml-Acros HCL -500ml-Acros 500ml ناموجود BioBasic
481 8-Hydroxyquinoline (8-Quinolinol) HD0274 100G ناموجود BioBasic
482 4- Isothiocyanatophenyl α-D- Mannopyranoside I905135 100mg ناموجود TRC
483 Ice Pack IB003 Pack ناموجود BioBasic
484 IPTG IB0168 25gr ناموجود BioBasic
485 IPTG IB0168-100G 100g ناموجود BioBasic
486 Imidazole IB0277 500g ناموجود BioBasic
487 Imidazole IB0277 100g ناموجود BioBasic
488 myo-inositol IB0536.SIZE.500G None ناموجود BioBasic
489 Iodoacetamide IB0539 5gr ناموجود BioBasic
490 ICE PACK ICE None ناموجود BioBasic
491 Kanamycin sulfate -1gr K4000 None ناموجود Sigma
492 Keratinase K4519-500UN None ناموجود None
493 TNF (Human) ELISA Kit KA0191 1Kit ناموجود Abnova
494 Il6 (Rat) ELISA Kit KA0278 kit ناموجود Abnova
495 Tnf (Rat) ELISA Kit KA0280 1 Kit ناموجود Abnova
496 Bdnf (Mouse) ELISA Kit KA0331 1 Kit ناموجود Abnova
497 MMP2 (Human) ELISA Kit KA0391 kit ناموجود Abnova
498 Annexin V-FITC Apoptosis Kit KA0714 1 Kit ناموجود Abnova
499 Annexin V-FITC Apoptosis Kit (Premium) using SYTXO green dye and annexin V-FITC for apoptosis detection. KA0715 1 Kit ناموجود Abnova
500 Caspase-3 Assay Kit (Colorimetric) KA0740 kit ناموجود Abnova
501 LDH-Cytotoxicity Assay Kit KA0785 1Kit ناموجود Abnova
502 Ammonia Assay Kit KA0810 1Kit ناموجود Abnova
503 Glucose Assay Kit KA0831 1Kit ناموجود Abnova
504 MTT Cell Viability Assay Kit KA1606 Kit ناموجود Abnova
505 ATPase/GTPase Assay Kit KA1610 1Kit ناموجود Abnova
506 Caspase Substrate Assay Kit (Colorimetric) KA3694 Kit ناموجود Abnova
507 a-2-Ketoglutaric acid, disodium salt, dihydrate KD0289 100gr ناموجود BioBasic
508 Lipopolysaccharides from Escherichia coli O111:B4 L2630-10MG None ناموجود Sigma
509 Luteinizing Hormone from sheep pituitary L5269 Vial ناموجود Sigma
510 Lactoperoxidase from Bovine Milk L8257 25mg ناموجود Sigma
511 L-Lysine, monohydrochloride LB0171 250gr ناموجود BioBasic
512 Lithium dodecyl sulfate LB0569 25G ناموجود BioBasic
513 L-Leucine LB0922 500G ناموجود BioBasic
514 L-Leucine LB0922 100gr ناموجود BioBasic
515 Light green SF, Yellowish LD0007 25g ناموجود BioBasic
516 Lithium chloride, anhydrous LDB0307 250gr ناموجود BioBasic
517 Lysozyme LDB0308 100G ناموجود BioBasic
518 Lithium nitrate-Acros-250G Lithium nitrate-Acro 250G ناموجود BioBasic
519 500-10000bp DNA Marker, Ready-to-use M101R-1 SIZE.100 loading None ناموجود BioBasic
520 100 bp-10 Kb Wide Range DNA Logical Marker, Ready to use16 D M103R-1 100 LOADING ناموجود BioBasic
521 100bp-1.5kb DNA Ladder Marker J4 ready to use 100,200,300,400,500,600,700,800,900,1000,1500bp M107R-1 100 Loading ناموجود BioBasic
522 100-1500bp DNA Marker, Ready-to-use M107R-1.Size.100 loadings None ناموجود BioBasic
523 MTT M2128 1gr ناموجود Sigma
524 Myricetin 500MG M2131-500MG None ناموجود Sigma
525 HSP70/HSP90AA1 monoclonal antibody,clone BB70 MAB2196 100ug ناموجود Abnova
526 MYD88 monoclonal antibody, clone 2E9C2 MAB2745 100ug ناموجود Abnova
527 Clostridium botulinum Toxin A monoclonal antibody, clone B36 MAB4095 1mL ناموجود Abnova
528 Clostridium botulinum Toxin B monoclonal antibody, clone B36 MAB4096 1mL ناموجود BioBasic
529 IL1R1 monoclonal antibody, clone BDI204 MAB4240 200ug ناموجود Abnova
530 Escherichia coli O157:H7 monoclonal antibody MAB5413 100ug ناموجود Abnova
531 5-Methylcytosine monoclonal antibody, clone 5MC-CD MAB6766 100ug ناموجود Abnova
532 MOPSO, free acid MB0234 25gr ناموجود BioBasic
533 Magnesium sulfate, heptahydrate, ACS MB0329 500G ناموجود BioBasic
534 D-Mannitol MB0335 500G ناموجود BioBasic
535 b-Mercaptoethanol MB0338 100ml ناموجود BioBasic
536 MES, free acid, monohydrate MB0341 25gr ناموجود BioBasic
537 MES, free acid, monohydrate MB0341-500G 500g ناموجود BioBasic
538 Methylene blue, chloride, trihydrate MB0342 250G ناموجود BioBasic
539 L-Methionine MB0346-10G 10g ناموجود BioBasic
540 L-Methionine MB0346-5G 5g ناموجود BioBasic
541 MOPS, free acid MB0360 100gr ناموجود BioBasic
542 MOPS, free acid MB0360-500G 500G ناموجود BioBasic
543 Melatonin MB0605 25G ناموجود BioBasic
544 MES, sodium salt MB0611 50gr ناموجود BioBasic
545 25mM MgCl2 MB1193 1.5ml ناموجود BioBasic
546 D-(+) Maltose, monohydrate MB4950 100G ناموجود BioBasic
547 Methanol MC6700 500ml ناموجود BioBasic
548 Mitomycin C MD0356M 10mg ناموجود BioBasic
549 Lambda DNA MDD22 100ug ناموجود BioBasic
550 Gibco™ EpiLife™ Medium. with 60µM calcium MEPI500CA None ناموجود Thermo
551 Gibco™ EpiLife™ CF Kit MEPICF500 None ناموجود Thermo
552 Maltose, monohydrate MIB1184 500G ناموجود BioBasic
553 Maltose, monohydrate MIB1184 100g ناموجود BioBasic
554 Premix WST-1 Cell Proliferation Assay System MK400 2500test ناموجود TaKaRa
555 LDH Cytotoxicity Detection Kit MK401 2,000 Tests ناموجود TaKaRa
556 Apoptosis Assay: In situ Apoptosis Detection Set MK500 20 Assays ناموجود TaKaRa
557 ApopLadder Ex MK600 ناموجود TaKaRa
558 Magnesium chloride, hexahydrate MRB0328 250gr ناموجود BioBasic
559 NADPH N1630 None ناموجود Sigma
560 N?-Nitro-L-arginine methyl ester hydrochloride N5751-250MG None ناموجود Sigma
561 Nisin from Lactococcus lactis-1gr N5764 None ناموجود Sigma
562 Nutrient Mixture F-10 Ham N6635-10L None ناموجود Sigma
563 β-Nicotinamide adenine dinucleotide 2′-phosphate reduced tetrasodium salt hydrate N7505 25mg ناموجود Sigma
564 pNPP-Na NB0365 5gr ناموجود BioBasic
565 Nystatin NB0390 25gr ناموجود BioBasic
566 NADH disodium salt, trihydrate, Reduced NB0642-5G 5g ناموجود BioBasic
567 N-(1-Naphthyl)-ethylenediamine dihydrochloride NB0650-10G 10g ناموجود None
568 Non-Fat Powdered Milk NB0669-100G 100g ناموجود BioBasic
569 Non-Fat Powdered Milk NB0669-50G 50g ناموجود BioBasic
570 1-Naphthaleneacetic acid NB0729 100gr ناموجود BioBasic
571 ONPG (2-Nitrophenyl β-D-galactopyranoside) ND0382 1gr ناموجود BioBasic
572 Nitrotetrazolium blue chloride (NBT) NDB0379 5gr ناموجود BioBasic
573 Nitrotetrazolium blue chloride (NBT).SIZE.5G NDB0379-5G 5g ناموجود BioBasic
574 Nitrocellulose Membrane NT020S1-5(20X20CM) ناموجود BioBasic
575 Ovalbumin, purified O705084 1gr ناموجود BioBasic
576 L-alfa-Phosphatidylethanolamine, dioleoyl* P1223-25MG None ناموجود Sigma
577 pH Standard solution, Red pH 4.0 P2304-100ML 100ML ناموجود BioBasic
578 pH Standard solution, pH 7.0 P2307-100ML 100ML ناموجود BioBasic
579 pH Standard solution pH9.0 P2309-100ML 100ML ناموجود BioBasic
580 CA2 (Human) Recombinant Protein P3488 100ug ناموجود Abnova
581 ADIPOQ (Human) Recombinant Protein P3520 100ug ناموجود Abnova
582 Poly galactrunic acid   P3889 100gr ناموجود Sigma
583 Potassium phosphate monobasic P5379 500gr ناموجود Sigma
584 Turbo3C Protease P5380 1mg ناموجود Abnova
585 Phenylmethanesulfonyl fluoride (PMSF) P7626 250mg ناموجود Sigma
586 Escherichia coli O157:H7 polyclonal antibody PAB13942 1mg ناموجود Abnova
587 Donkey Anti-Human IgG (H&L) secondary antibody PAB9276 2mg ناموجود Abnova
588 Phenol red PB0420-10G 10g ناموجود BioBasic
589 L-Phenylalanine PB0422 100gr ناموجود BioBasic
590 PMSF PB0425 5g ناموجود BioBasic
591 PEG 8000 PB0433 500gr ناموجود BioBasic
592 PEG 8000 .SIZE.100G PB0433-100g None ناموجود BioBasic
593 Potassium hydroxide PB0441 500gr ناموجود BioBasic
594 Potassium iodide   PB0443 50gr ناموجود BioBasic
595 Proteinase K PB0451.SIZE.1G 1g ناموجود BioBasic
596 Pancreatin-5.0 (5XUSP)from hog pancreas PB0680 100gr ناموجود BioBasic
597 Pepsin 1: 10,000 PB0688 100gr ناموجود BioBasic
598 Phytagel PB0714-50G 50G ناموجود BioBasic
599 PIPES, free acid PB0719 100g ناموجود BioBasic
600 Paraffin oil (Mineral oil), light fraction PC5530 100ml ناموجود BioBasic
601 Paraffin oil (Mineral oil), heavy fraction PC5531 100ml ناموجود BioBasic
602 Pyridine PC8700 1lit ناموجود BioBasic
603 10x Taq Buffer (MgCl2) PCRB16 1.5ml ناموجود BioBasic
604 10x Taq Buffer (NH4)2SO4 PCRB55 1.5ml ناموجود BioBasic
605 10x PCR Buffer PCRB60 1.5ml ناموجود BioBasic
606 PBS (Phosphate BuffeRed Saline), powdered PD0100 1PK ناموجود BioBasic
607 Pyridoxal-5"-phosphate. monohydrate PD0455-5g None ناموجود BioBasic
608 Phenol-100cc-Sciense Phenol-100cc-Sciense 100cc ناموجود BioBasic
609 Valproic acid PHR1061-1G 1g ناموجود None
610 Slide-A-Lyzer® Dialysis Cassettes and Kits, MWCO 3500 to 10000 PI66330 cassette ناموجود Thermo
611 Puromycin, dihydrochloride .SIZE.25MG PJ593 ناموجود BioBasic
612 One-Tube Plant Genomic DNA Extraction Kit PT71816 100preps ناموجود BioBasic
613 MRS Broth- Qlab- 100g QB-65-2285 None ناموجود Qlab
614 Green-2-Go 1-Step TaqProbe qRT-PCR Mastermix-no Dye(100x20ul Rxn) QPCR008-NODYE.100 None ناموجود BioBasic
615 TaKaRa Taq™ DNA Polymerase R001A 250 Units ناموجود TaKaRa
616 TaKaRa Taq™ DNA Polymerase (with Mg2+ free buffer) R001AM 250 Units ناموجود TaKaRa
617 Pyrobest™ DNA Polymerase R005A 125 U ناموجود TaKaRa
618 PrimeSTAR® HS DNA Polymerase R010A 250 Units ناموجود TaKaRa
619 PCR Amplificat_numberion Kit R011 100 Rxns ناموجود TaKaRa
620 رک 11 خانه مخصوص تیوب سانتریفیوژ R011-N Pack ناموجود BioBasic
621 رک 12 خانه مخصوص تیوب سانتریفیوژ R012-N Pack ناموجود BioBasic
622 رک 24 خانه مخصوص تیوب سانتریفیوژ R024-N Pack ناموجود BioBasic
623 PrimeSTAR® GXL DNA Polymerase R050A 250 Units ناموجود TaKaRa
624 PrimeSTAR® GXL DNA Polymerase R050Q 50 Units ناموجود TaKaRa
625 Xcm I R0533S 1000U ناموجود NEB
626 Methylation Specific PCR: EpiScope MSP Kit R100A 200 Rxns ناموجود TaKaRa
627 رک 96 خانه 5 لایه مخصوص سرسمپلر 200میکرولیتر قابل اتوکلاو با کاور RA225-5LR 5*96rack ناموجود BioBasic
628 رک مخصوص سرسمپلر زرد RA226BR rack ناموجود BioBasic
629 RNase A RB0473-100mg None ناموجود BioBasic
630 RNase A Solution (10mg/m.SIZE.1MLl) RB0474 ناموجود BioBasic
631 Ribonuclease inhibitor RB0478 5ku ناموجود BioBasic
632 Fibroblast Growth Factor-Basic ; human FGF-basic RC215 13-10UG ناموجود BioBasic
633 Epidermal Growth Factor; human EGF RC216 15-100UG ناموجود BioBasic
634 Vascular Endothelial Growth Factor 165; human VEGF165 RC216-16 10ug ناموجود BioBasic
635 Interleukin-4 . murine IL-4 RC232-15.Size.20ug None ناموجود BioBasic
636 Riboflavin RD0470 100gr ناموجود BioBasic
637 Plastic Foam Racks, Octagonal, 83X12MM RF024 83X12MM ناموجود BioBasic
638 Plastic Foam Racks, Circle 83X12MM RF025 83X12MM ناموجود BioBasic
639 Plastic Foam Racks, Triangle, 86X12MM RF026 86X12MM ناموجود BioBasic
640 TaKaRa Ex Taq® DNA Polymerase RR001A 250unit ناموجود TaKaRa
641 A High Fidelity PCR Enzyme for Long Range PCR: LA Taq DNA Polymerase RR002A 125 Units ناموجود TaKaRa
642 TaKaRa LA Taq® DNA Polymerase (Mg2+ plus buffer) RR002M 250 Units ناموجود TaKaRa
643 PrimeScript RT-PCR Kit RR014A Kit ناموجود TaKaRa
644 TaKaRa Ex Taq Mg2+ free buffer RR01AM 250u ناموجود TaKaRa
645 PrimeScript™ RT Reagent Kit Fast, efficient synthesis of 1st strand cDNA ready for Real Time RR037A 200 react ناموجود TaKaRa
646 PrimeScript™ RT Reagent Kit Fast, efficient synthesis of 1st strand cDNA ready for Real Time RR037Q 20 react ناموجود TaKaRa
647 One Step RT-PCR Kit Ver. 2 RR055A 50 react ناموجود TaKaRa
648 Multiplex PCR Assay Kit Ver.2 RR062A 100 Rxns ناموجود TaKaRa
649 One Step PrimeScript™ RT-PCR Kit. (Perfect Real Time) RR064A 100 react ناموجود TaKaRa
650 One-Step SYBR® PrimeScript™ RT-PCR Kit (Perfect Real Time) RR066A 100 Rxns ناموجود TaKaRa
651