لیست محصولات

×

آیا سوالی دارید؟ با ما تماس بگیرید.تلفن: (021)44260285(4 خط) - تلگرام: +989391127651

محصولات موجود

آخرین به روزرسانی: 1399-03-16 19:00
# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1

Rox I6

40 ul 1,200,000 TaKaRa مشاهده محصول افزودن به سبد خرید
2

Rox II6

- 100µl 1,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
3

Eco T22 I Ava III Nsil 2000u TaKara 6

1125A 2000 u 14,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
4

Asu II-2500 u TaKaRa6

1225A 2500 u 12,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
5

Ribonuclease H (RNase H) 1000units TaKaRa 6

2150A 1000U 8,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
6

BcaBEST DNA Polymerase 300U6

2770Q 300u 2,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
7

pUC 19 DNA 6

3219 None 12,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
8

Universal GenomeWalker 2.0 6

636405 None 180,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
9

SeqAmp DNA Polymerase 6

638504 None 22,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
10

10X Takara Taq Buffer (Mg2+ free) 6

9151AM-1ML None 1,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
11

2X GC Buffer I6

9154-1.5ml None 1,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
12

2X GC Buffer II6

9155 1.25ml 1,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
13

Loading buffer -10X 1vial6

9157-1Vial vials 950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
14

Esay Dilution 1 pak6

9160 1ml 25,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
15

PFU DNA Polymerase,5U/UL 100U6

B0093(D0090P)-100U 100u 5,950,000 BioBasic مشاهده محصول افزودن به سبد خرید
16

TSG DNA POLYMERASE, 5U/UL.SIZE. 2006

D0081-200U 200u 3,500,000 BioBasic مشاهده محصول افزودن به سبد خرید
17

dNTP mixture (10mM) 0.5ML6

DD0056-0.5ml 0.5ml 2,950,000 BioBasic مشاهده محصول افزودن به سبد خرید
18

TAQ DNA POLYMERASE-500U 6

HTD0078 None 3,950,000 BioBasic مشاهده محصول افزودن به سبد خرید
19

TAQ DNA POLYMERASE (HIGH PURITY),50U/UL.SIZE.1KU6

HTD0078 1000U 6,500,000 BioBasic مشاهده محصول افزودن به سبد خرید
20

TAQ DNA POLYMERASE-200U 6

HTD0078 200u 1,950,000 BioBasic مشاهده محصول افزودن به سبد خرید
21

MgCl2 1.5ml6

MB1193-1.5ml 1.5ml 950,000 BioBasic مشاهده محصول افزودن به سبد خرید
22

10x Taq Buffer (MgCl2)1.5ml6

PCRB16-1.5ml 950,000 BioBasic مشاهده محصول افزودن به سبد خرید
23

10x Taq Buffer (NH4)2SO4.SIZE.1.5ml6

PCRB55-1.5ML 950,000 BioBasic مشاهده محصول افزودن به سبد خرید
24

10xTaq Buffer.SIZE.1.5ml6

PCRB60-1.5ml 1.5ml 950,000 BioBasic مشاهده محصول افزودن به سبد خرید
25

Green-2-Go 2X qPCR-S Mastermix6

QPCR004-S-1.25ML None 8,500,000 BioBasic مشاهده محصول افزودن به سبد خرید
26

Hs_ALPL_1_SG QuantiTect Primer Assay (200) Qiagen6

QT00012957 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
27

Hs_SPARC_1_SG QuantiTect Primer Assay (200) Qiagen6

QT00018620 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
28

Hs-RB1-1-SG QuantiTect primer assay (200)Qiagen6

QT00066899 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
29

Hs_BGLAP_1_SG QuantiTect Primer Assay (200) Qiagen6

QT00232771 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
30

Hs_SPP1_1_SG QuantiTect Primer Assay (200) Qiagen6

QT01008798 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
31

Taq DNA polymerase 50 unit6

R001Q None 3,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
32

TaKaRa Taq Hot Start 50 units 6

R007Q None 4,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
33

TaKaRa EX Taq Hot Start 250 units6

RR006A None 22,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
34

SpeedSTAR Taq 50 units 6

RR070Q 50 Units 3,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
35

EmeraldAmp GT PCR Master Mix TaKaRa 160t6

RR310A 4ml 18,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
36

EmeraldAmp GT PCR Master Mix TaKaRa 40t6

RR310Q 1ml 4,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
37

SapphireAmp Fast PCR Master Mix 40 Reaction Takara6

RR350Q 1 ml 5,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
38

Premix Ex Taq Probe qPCR 200rxns6

RR390A None 48,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
39

Premix Ex Taq TM Probe qPCR 40rxns6

RR390Q 1ml 10,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
40

SYBR Premix Ex Taq2 (Tli Plus) 200T6

RR820A 200 Rxns 49,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
41

SYBR Premix Ex Taq2 (Tli Plus) 40T6

RR820Q 1ml 10,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
42

High purity PCR Master Mix6

SP001-40-1ml 1 mL 900,000 Aminsan مشاهده محصول افزودن به سبد خرید
43

Water, Ultra Pure, Free of DNase, RNase, Protease, Endonuclease6

WA001-0125 1.25 mL 180,000 Aminsan مشاهده محصول افزودن به سبد خرید

محصولات ناموجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 Buffer Taq*10 None ناموجود TaKaRa
2 Prime STAR (high fidelity PCR) 50 u None ناموجود TaKaRa
3 Buffer MgSo4 None ناموجود TaKaRa
4 Buffer Z None ناموجود TaKaRa
5 سنتز پرایمر Page 100nmol None ناموجود BioBasic
6 4th WHO International Standard for HBV DNA for NAT 10/266 None ناموجود NIBSC
7 Buffer PCR 1000 1ml ناموجود TaKaRa
8 Buffer H 1000 Vial ناموجود TaKaRa
9 Afa I (Rsa I ) 1000 units 1116A 1000U ناموجود TaKaRa
10 Hepatitis C virus (HCV) For nucleic acid amplification techniques (5th International standard 2015) 14/150 None ناموجود NIBSC
11 Non WHO Reference Material 4th HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques 14/290 None ناموجود NIBSC
12 in vivo jetPEI Transfection Reagent (glucose inclus) 201-10G None ناموجود Poly Plus
13 DNA Polymerase I(E.coli) 2130A 500 Units ناموجود TaKaRa
14 Klenow Fragment 2140A 200unit ناموجود TaKaRa
15 Poly(A) Polymerase 2180A 20 Units ناموجود TaKaRa
16 Recombinant RNase Inhibitor 2313A 5000u ناموجود TaKaRa
17 Recombinant RNase Inhibitor 2313Q 500U ناموجود TaKaRa
18 PrimeScript™ Reverse Transcriptase 2680A 10000u ناموجود TaKaRa
19 PrimeScript™ Reverse Transcriptase 2680Q 2000u ناموجود TaKaRa
20 pRl201-AN DNA 3264 ناموجود TaKaRa
21 T-Vector pMD20 3270 1 ug ناموجود TaKaRa
22 Chaperone Plasmid Set 3340 1 Set ناموجود TaKaRa
23 pCold DNA Cold Shock Expression System 3360 1 Set ناموجود TaKaRa
24 CellAmp™ Direct RNA Prep Kit for RT-PCR (Real Time) 3732 200 Rxns ناموجود TaKaRa
25 dATP 4026 100 umol ناموجود TaKaRa
26 dGTP 4027 100 umol ناموجود TaKaRa
27 dCTP 4028 100 umol ناموجود TaKaRa
28 dTTP 4029 100 umol ناموجود TaKaRa
29 dNTP mixture 4030 1.28 ml ناموجود TaKaRa
30 میکرولیتر Dntp 180 4030 180ul ناموجود TaKaRa
31 cDNA synthesis kit: PrimeScript First Strand cDNA Synthesis Kit 6110A 50 Rxns ناموجود TaKaRa
32 3'-Full RACE Core Set 6121 20 react ناموجود TaKaRa
33 3'-Full RACE Core Set 6122 10 react ناموجود TaKaRa
34 PrimeScript II 1st strand cDNA synthesis kit 6210A Kit ناموجود TaKaRa
35 Lenti-X™ qRT-PCR Titration Kit 200 Rnx Clontech 631235 1kit ناموجود TaKaRa
36 Real Time qPCR Master Mix - Terra qPCR Direct SYBR Premix 638319 ناموجود TaKaRa
37 CloneAmp HiFi PCR Premix 639298-50rxns None ناموجود TaKaRa
38 HRV 3C Protease 500U 7360 None ناموجود TaKaRa
39 E. coli HB101 Competent Cells 9051 Set ناموجود TaKaRa
40 GC Buffer I 9154 1.25ml ناموجود TaKaRa
41 High Reverse Transcriptase (RNase H-, 10000 U) 9K-005-0005-10000U None ناموجود BioBasic
42 Taq DNA Polymerase, 5U/UL B0089 200u ناموجود BioBasic
43 Taq DNA Polymerase, 5U/UL B0089(D0089) 1000u ناموجود BioBasic
44 TAQ DNA POLYMERASE, 5U/UL.SIZE.500U B0089(D0089)-500U None ناموجود BioBasic
45 PFU DNA POLYMERASE, 5U/UL.SIZE.500U B0093(D0090P)-500U None ناموجود BioBasic
46 RNase H, 10U/UL BEN0202 500u ناموجود BioBasic
47 RNase I, 10U/UL BEN0601 1 Ku ناموجود BioBasic
48 Mini gene synthesis 151bp with subcloning pUC57 BHV1 None ناموجود BioBasic
49 Mini gene synthesis 204bp with subcloning pUC57 BPI3 None ناموجود BioBasic
50 Mini gene synthesis 252bp with subcloning pUC57 BRSV None ناموجود BioBasic
51 Mini gene synthesis 185bp with subcloning pUC57 BVDV1 None ناموجود BioBasic
52 Mini gene synthesis 193bp with subcloning pUC57 BVDV2 None ناموجود BioBasic
53 TSG DNA POLYMERASE, 5U/UL.SIZE. 200 u D0081-200u None ناموجود BioBasic
54 DNAfectamine DNAF001-0.1ML None ناموجود BioBasic
55 DNAfectamine DNAF001-0.3ML None ناموجود BioBasic
56 Alu I ER0011 600U ناموجود Thermo
57 Gene synthesis 336bp Gene Synthesis AMINO073 None ناموجود BioBasic
58 Oligo synthesis HAP Purification OD2 H510001-0002 None ناموجود BioBasic
59 5X All-In-One RT MasterMix (50ul) HRT025-10.25RXNS None ناموجود BioBasic
60 5X All-In-One RT MasterMix (200ul) HRT100-10.100RXNS None ناموجود BioBasic
61 5X All-In-One RT MasterMix (400ul) HRT200-10.SIZE.200 None ناموجود BioBasic
62 Gene synthesis 1683bp AMINO070 J508021-0001 None ناموجود BioBasic
63 Subcloning Service pCDH-CMV J508022-0001 None ناموجود BioBasic
64 25mM MgCl2 MB1193 1.5ml ناموجود BioBasic
65 10x Taq Buffer (MgCl2) PCRB16 1.5ml ناموجود BioBasic
66 10x Taq Buffer (NH4)2SO4 PCRB55 1.5ml ناموجود BioBasic
67 10x PCR Buffer PCRB60 1.5ml ناموجود BioBasic
68 Mini gene synthesis 269bp with subcloning pUC57 PCV1 None ناموجود BioBasic
69 Mini gene synthesis 175bp with subcloning pUC57 PHEV1 None ناموجود BioBasic
70 Green-2-Go TaqProbe qPCR Mastermix-no Dye ) QPCR005-NODYE.1.25ML None ناموجود BioBasic
71 Green-2-Go 1-Step qRT-PCR Mastermix-No Dye (100X20ul Rxn) QPCR007-NODYE.100 None ناموجود BioBasic
72 Green-2-Go 1-Step TaqProbe qRT-PCR Mastermix-no Dye(100x20ul Rxn) QPCR008-NODYE.100 None ناموجود BioBasic
73 TaKaRa Taq™ DNA Polymerase R001A 250 Units ناموجود TaKaRa
74 TaKaRa Taq™ DNA Polymerase (with Mg2+ free buffer) R001AM 250 Units ناموجود TaKaRa
75 Pyrobest™ DNA Polymerase R005A 125 U ناموجود TaKaRa
76 PrimeSTAR® HS DNA Polymerase R010A 250 Units ناموجود TaKaRa
77 PCR Amplificat_numberion Kit R011 100 Rxns ناموجود TaKaRa
78 PrimeSTAR® GXL DNA Polymerase R050A 250 Units ناموجود TaKaRa
79 PrimeSTAR® GXL DNA Polymerase R050Q 50 Units ناموجود TaKaRa
80 Xcm I R0533S 1000U ناموجود NEB
81 Methylation Specific PCR: EpiScope MSP Kit R100A 200 Rxns ناموجود TaKaRa
82 RNase A RB0473 25mg ناموجود BioBasic
83 Ribonuclease inhibitor RB0478 5ku ناموجود BioBasic
84 TaKaRa Ex Taq® DNA Polymerase RR001A 250unit ناموجود TaKaRa
85 A High Fidelity PCR Enzyme for Long Range PCR: LA Taq DNA Polymerase RR002A 125 Units ناموجود TaKaRa
86 TaKaRa LA Taq® DNA Polymerase (Mg2+ plus buffer) RR002M 250 Units ناموجود TaKaRa
87 TaKaRa EX Taq Hot Start 50 units RR006Q None ناموجود TaKaRa
88 TaKaRa EX Taq Hot Start 20 units RR006Q-20U None ناموجود TaKaRa
89 PrimeScript RT-PCR Kit RR014A Kit ناموجود TaKaRa
90 TaKaRa Ex Taq Mg2+ free buffer RR01AM 250u ناموجود TaKaRa
91 Real Time one step RNA PCR kit, Version 2 RR026 100 Test ناموجود TaKaRa
92 cDNA Kit TaKaRa RR037A 200 react ناموجود TaKaRa
93 cDNA Kit TaKaRa-100rxns RR037A-100rxns None ناموجود TaKaRa
94 cDNA Kit TaKaRa-50rxns RR037A-50rxns None ناموجود TaKaRa
95 PrimeScript RT reagent Kit (PRT) 20 test RR037Q 20 react ناموجود TaKaRa
96 TaKaRa LA Taq HS (dNTP inclus) RR042Q None ناموجود TaKaRa
97 One Step RT-PCR Kit Ver. 2 RR055A 50 react ناموجود TaKaRa
98 Multiplex PCR Assay Kit Ver.2 RR062A 100 Rxns ناموجود TaKaRa
99 One Step PrimeScript RT_PCR Kit 100 react. RR064A 100 react ناموجود TaKaRa
100 One Step SYBRPrime Script RT-PCR 100react TaKaRa RR086A 100 react ناموجود TaKaRa
101 SYBR® Premix DimerEraser™ (Perfect Real Time) RR091A 200 Rxns ناموجود TaKaRa
102 EmeraldAmp Max PCR Master Mix RR320A 4ml ناموجود TaKaRa
103 EmeraldAmp Max PCR Master Mix RR320Q 1ml ناموجود TaKaRa
104 EmeraldAmpMaxHS PCR Master Mix - (RR330A) RR330A 4ml ناموجود TaKaRa
105 EmeraldAmp Max HS PCR Master Mix RR330A 4ml ناموجود TaKaRa
106 EmeraldAmp MAX HS PCR master mix RR330Q 1 ml  ناموجود TaKaRa
107 SapphireAmp Fast PCR Master Mix160Test Takara RR350A 4 ml ناموجود TaKaRa
108 Premix Ex Taq (Probe qPCR) RR390L 5ml ناموجود TaKaRa
109 SYBR Premix Ex Taq II (Tli Plus) RR820L 5ml ناموجود TaKaRa
110 SYBR Premix Ex Taq2 (Tli Plus) 25ml RR820W 25ml ناموجود TaKaRa
111 Mini gene synthesis 181bp with subcloning pUC57 Rabies V None ناموجود BioBasic
112 RetroNectin® Recombinant Human Fibronectin Fragment T100A 0.5 mg ناموجود TaKaRa
113 Retro Nectin T100B None ناموجود TaKaRa
114 RetroNectin® Pre-coated Dish T110A plates ناموجود TaKaRa
115 Mini gene synthesis 233bp with subcloning pUC57 TGEV None ناموجود BioBasic
116 TACCAAGAGAACTACATATCCGATGACCTTCCGTGGGGCCTAGTAGTTGCGGGACTACTAGACACTGTATGA apte zia-72bp None ناموجود BioBasic
117 Millieu de transfection des Plasmides sc-108062 None ناموجود Santa Cruz
118 Réactif de Transfection Ultracruz® sc-395739 None ناموجود Santa Cruz
119 Plasmide de Contrôle CRISPR/Cas9 sc-418922 None ناموجود Santa Cruz
120 AAUAAAGCGUUCUGUCAACC 20bp OD5 HPLC Purification siRNA1 None ناموجود BioBasic
121 GGAUGCUAUUGUGAAUGUGTT 21bp OD5 HPLC Purification siRNA3b None ناموجود BioBasic
122 سنتز ژن subcloning PUC57-803bp سنتز ژن subcloning P 804bp ناموجود BioBasic