لیست محصولات

×

آیا سوالی دارید؟ با ما تماس بگیرید.تلفن: (021)44260285(4 خط) - تلگرام: +989391127651

محصولات موجود

آخرین به روزرسانی: 1399-07-07 11:01
# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1

Rox I

40 ul 1,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
2

Rox II

- 100µl 1,100,000 TaKaRa مشاهده محصول افزودن به سبد خرید
3

Eco T22 I Ava III Nsil 2000u TaKara

1125A 2000 u 14,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
4

Asu II-2500 u TaKaRa

1225A 2500 u 12,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
5

pUC 19 DNA

3219 None 19,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
6

Universal GenomeWalker 2.0

636405 None 220,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
7

SeqAmp DNA Polymerase

638504 None 25,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
8

10X Takara Taq Buffer (Mg2+ free)

9151AM-1ML None 1,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
9

2X GC Buffer I

9154-1.5ml None 1,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
10

2X GC Buffer II

9155 1.25ml 1,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
11

Loading buffer -10X 1vial

9157-1Vial vials 1,200,000 TaKaRa مشاهده محصول افزودن به سبد خرید
12

Esay Dilution-1ML

9160-1ML None 2,500,000 TaKaRa مشاهده محصول افزودن به سبد خرید
13

TSG DNA POLYMERASE, 5U/UL.SIZE. 200

D0081-200U 200u 3,500,000 BioBasic مشاهده محصول افزودن به سبد خرید
14

DNASE I, RNASE FREE.SIZE.1000U

EADN01-1000U None 5,950,000 Aminsan مشاهده محصول افزودن به سبد خرید
15

TAQ DNA POLYMERASE-200U

HTD0078 200u 1,950,000 BioBasic مشاهده محصول افزودن به سبد خرید
16

TAQ DNA POLYMERASE (HIGH PURITY),50U/UL.SIZE.1KU

HTD0078 1000U 6,500,000 BioBasic مشاهده محصول افزودن به سبد خرید
17

TAQ DNA POLYMERASE-500U

HTD0078 None 3,950,000 BioBasic مشاهده محصول افزودن به سبد خرید
18

10x Taq Buffer (MgCl2)1.5ml

PCRB16-1.5ml 950,000 BioBasic مشاهده محصول افزودن به سبد خرید
19

10x Taq Buffer (NH4)2SO4.SIZE.1.5ml

PCRB55-1.5ML 950,000 BioBasic مشاهده محصول افزودن به سبد خرید
20

10xTaq Buffer.SIZE.1.5ml

PCRB60-1.5ml 1.5ml 950,000 BioBasic مشاهده محصول افزودن به سبد خرید
21

Green-2-Go 2X qPCR-S Mastermix

QPCR004-S-1.25ML None 8,500,000 BioBasic مشاهده محصول افزودن به سبد خرید
22

Hs_ALPL_1_SG QuantiTect Primer Assay (200) Qiagen

QT00012957 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
23

Hs_SPARC_1_SG QuantiTect Primer Assay (200) Qiagen

QT00018620 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
24

Hs-RB1-1-SG QuantiTect primer assay (200)Qiagen

QT00066899 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
25

Hs_BGLAP_1_SG QuantiTect Primer Assay (200) Qiagen

QT00232771 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
26

Hs_SPP1_1_SG QuantiTect Primer Assay (200) Qiagen

QT01008798 Pack 25,000,000 Qiagen مشاهده محصول افزودن به سبد خرید
27

Taq DNA polymerase 50 unit

R001Q None 3,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
28

TaKaRa Taq Hot Start 50 units

R007Q None 4,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
29

Mgcl2 50mM-1.25ml

R01050-0125 None 450,000 Aminsan مشاهده محصول افزودن به سبد خرید
30

TaKaRa EX Taq Hot Start 50 units

RR006Q None 6,950,000 TaKaRa مشاهده محصول افزودن به سبد خرید
31

Premix Ex Taq Probe qPCR 200rxns

RR390A None 55,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
32

Premix Ex Taq TM Probe qPCR 40rxns

RR390Q 1ml 12,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
33

SYBR Premix Ex Taq2 (Tli Plus) 200T

RR820A 200 Rxns 55,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
34

SYBR Premix Ex Taq2 (Tli Plus) 40T

RR820Q 1ml 12,000,000 TaKaRa مشاهده محصول افزودن به سبد خرید
35

High purity PCR Master Mix

SP001-40-1ml 1 mL 900,000 Aminsan مشاهده محصول افزودن به سبد خرید
36

water nuclease free PCR grade-1.25ML

WA001-0125 1.25 mL 200,000 Aminsan مشاهده محصول افزودن به سبد خرید
37

water nuclease free PCR grade-1ML

WA001-1ML None 250,000 Aminsan مشاهده محصول افزودن به سبد خرید

محصولات ناموجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 سنتز پرایمر Page 100nmol None ناموجود BioBasic
2 Buffer Z None ناموجود TaKaRa
3 Buffer MgSo4 None ناموجود TaKaRa
4 Prime STAR (high fidelity PCR) 50 u None ناموجود TaKaRa
5 Buffer Taq*10 None ناموجود TaKaRa
6 4th WHO International Standard for HBV DNA for NAT 10/266 None ناموجود NIBSC
7 Buffer PCR 1000 1ml ناموجود TaKaRa
8 Buffer H 1000 Vial ناموجود TaKaRa
9 Afa I (Rsa I ) 1000 units 1116A 1000U ناموجود TaKaRa
10 Hepatitis C virus (HCV) For nucleic acid amplification techniques (5th International standard 2015) 14/150 None ناموجود NIBSC
11 Non WHO Reference Material 4th HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques 14/290 None ناموجود NIBSC
12 in vivo jetPEI Transfection Reagent (glucose inclus) 201-10G None ناموجود Poly Plus
13 DNA Polymerase I(E.coli) 2130A 500 Units ناموجود TaKaRa
14 Klenow Fragment 2140A 200unit ناموجود TaKaRa
15 Ribonuclease H (RNase H) 1000units TaKaRa 2150A 1000U ناموجود TaKaRa
16 Poly(A) Polymerase 2180A 20 Units ناموجود TaKaRa
17 Recombinant RNase Inhibitor 2313A 5000u ناموجود TaKaRa
18 Recombinant RNase Inhibitor 2313Q 500U ناموجود TaKaRa
19 PrimeScript™ Reverse Transcriptase 2680A 10000u ناموجود TaKaRa
20 PrimeScript™ Reverse Transcriptase 2680Q 2000u ناموجود TaKaRa
21 BcaBEST DNA Polymerase 300U 2770Q 300u ناموجود TaKaRa
22 pRl201-AN DNA 3264 ناموجود TaKaRa
23 T-Vector pMD20 3270 1 ug ناموجود TaKaRa
24 Chaperone Plasmid Set 3340 1 Set ناموجود TaKaRa
25 pCold DNA Cold Shock Expression System 3360 1 Set ناموجود TaKaRa
26 CellAmp™ Direct RNA Prep Kit for RT-PCR (Real Time) 3732 200 Rxns ناموجود TaKaRa
27 dATP 4026 100 umol ناموجود TaKaRa
28 dGTP 4027 100 umol ناموجود TaKaRa
29 dCTP 4028 100 umol ناموجود TaKaRa
30 dTTP 4029 100 umol ناموجود TaKaRa
31 میکرولیتر Dntp 180 4030 180ul ناموجود TaKaRa
32 dNTP mixture 4030 1.28 ml ناموجود TaKaRa
33 cDNA synthesis kit: PrimeScript First Strand cDNA Synthesis Kit 6110A 50 Rxns ناموجود TaKaRa
34 3'-Full RACE Core Set 6121 20 react ناموجود TaKaRa
35 3'-Full RACE Core Set 6122 10 react ناموجود TaKaRa
36 PrimeScript II 1st strand cDNA synthesis kit 6210A Kit ناموجود TaKaRa
37 Lenti-X™ qRT-PCR Titration Kit 200 Rnx Clontech 631235 1kit ناموجود TaKaRa
38 Real Time qPCR Master Mix - Terra qPCR Direct SYBR Premix 638319 ناموجود TaKaRa
39 CloneAmp HiFi PCR Premix 639298-50rxns None ناموجود TaKaRa
40 HRV 3C Protease 500U 7360 None ناموجود TaKaRa
41 E. coli HB101 Competent Cells 9051 Set ناموجود TaKaRa
42 GC Buffer I 9154 1.25ml ناموجود TaKaRa
43 Esay Dilution 1 pak 9160 1ml ناموجود TaKaRa
44 High Reverse Transcriptase (RNase H-, 10000 U) 9K-005-0005-10000U None ناموجود BioBasic
45 Taq DNA Polymerase, 5U/UL B0089 200u ناموجود BioBasic
46 Taq DNA Polymerase, 5U/UL B0089(D0089) 1000u ناموجود BioBasic
47 TAQ DNA POLYMERASE, 5U/UL.SIZE.500U B0089(D0089)-500U None ناموجود BioBasic
48 PFU DNA Polymerase,5U/UL 100U B0093(D0090P)-100U 100u ناموجود BioBasic
49 PFU DNA POLYMERASE, 5U/UL.SIZE.500U B0093(D0090P)-500U None ناموجود BioBasic
50 RNase H, 10U/UL BEN0202 500u ناموجود BioBasic
51 RNase I, 10U/UL BEN0601 1 Ku ناموجود BioBasic
52 Mini gene synthesis 151bp with subcloning pUC57 BHV1 None ناموجود BioBasic
53 Mini gene synthesis 204bp with subcloning pUC57 BPI3 None ناموجود BioBasic
54 Mini gene synthesis 252bp with subcloning pUC57 BRSV None ناموجود BioBasic
55 Mini gene synthesis 185bp with subcloning pUC57 BVDV1 None ناموجود BioBasic
56 Mini gene synthesis 193bp with subcloning pUC57 BVDV2 None ناموجود BioBasic
57 TSG DNA POLYMERASE, 5U/UL.SIZE. 200 u D0081-200u None ناموجود BioBasic
58 dNTP mixture (10mM) 0.5ML DD0056-0.5ml 0.5ml ناموجود BioBasic
59 DNASE I, RNASE FREE.SIZE.50KU DD0649-50KU None ناموجود BioBasic
60 DNAfectamine DNAF001-0.1ML None ناموجود BioBasic
61 DNAfectamine DNAF001-0.3ML None ناموجود BioBasic
62 Alu I ER0011 600U ناموجود Thermo
63 Gene synthesis 336bp Gene Synthesis AMINO073 None ناموجود BioBasic
64 Oligo synthesis HAP Purification OD2 H510001-0002 None ناموجود BioBasic
65 5X All-In-One RT MasterMix (50ul) HRT025-10.25RXNS None ناموجود BioBasic
66 5X All-In-One RT MasterMix (200ul) HRT100-10.100RXNS None ناموجود BioBasic
67 5X All-In-One RT MasterMix (400ul) HRT200-10.SIZE.200 None ناموجود BioBasic
68 TAQ DNA POLYMERASE (HIGH PURITY),1u HTD0078-1u None ناموجود BioBasic
69 Gene synthesis 1683bp AMINO070 J508021-0001 None ناموجود BioBasic
70 Subcloning Service pCDH-CMV J508022-0001 None ناموجود BioBasic
71 25mM MgCl2 MB1193 1.5ml ناموجود BioBasic
72 MgCl2 1.5ml MB1193-1.5ml 1.5ml ناموجود BioBasic
73 NTP Mixture (10mM) ND0056-0.5ML None ناموجود BioBasic
74 10x Taq Buffer (MgCl2) PCRB16 1.5ml ناموجود BioBasic
75 10x Taq Buffer (NH4)2SO4 PCRB55 1.5ml ناموجود BioBasic
76 10x PCR Buffer PCRB60 1.5ml ناموجود BioBasic
77 Mini gene synthesis 269bp with subcloning pUC57 PCV1 None ناموجود BioBasic
78 Mini gene synthesis 175bp with subcloning pUC57 PHEV1 None ناموجود BioBasic
79 Green-2-Go TaqProbe qPCR Mastermix-no Dye ) QPCR005-NODYE.1.25ML None ناموجود BioBasic
80 Green-2-Go 1-Step qRT-PCR Mastermix-No Dye (100X20ul Rxn) QPCR007-NODYE.100 None ناموجود BioBasic
81 Green-2-Go 1-Step TaqProbe qRT-PCR Mastermix-no Dye(100x20ul Rxn) QPCR008-NODYE.100 None ناموجود BioBasic
82 TaKaRa Taq™ DNA Polymerase R001A 250 Units ناموجود TaKaRa
83 TaKaRa Taq™ DNA Polymerase (with Mg2+ free buffer) R001AM 250 Units ناموجود TaKaRa
84 Pyrobest™ DNA Polymerase R005A 125 U ناموجود TaKaRa
85 PrimeSTAR® HS DNA Polymerase R010A 250 Units ناموجود TaKaRa
86 PCR Amplificat_numberion Kit R011 100 Rxns ناموجود TaKaRa
87 PrimeSTAR® GXL DNA Polymerase R050A 250 Units ناموجود TaKaRa
88 PrimeSTAR® GXL DNA Polymerase R050Q 50 Units ناموجود TaKaRa
89 Xcm I R0533S 1000U ناموجود NEB
90 Methylation Specific PCR: EpiScope MSP Kit R100A 200 Rxns ناموجود TaKaRa
91 Ribonuclease inhibitor RB0478 5ku ناموجود BioBasic
92 Ribonuclease inhibitor.SIZE.1KU RB0478-1KU None ناموجود BioBasic
93 TaKaRa Ex Taq® DNA Polymerase RR001A 250unit ناموجود TaKaRa
94 A High Fidelity PCR Enzyme for Long Range PCR: LA Taq DNA Polymerase RR002A 125 Units ناموجود TaKaRa
95 TaKaRa LA Taq® DNA Polymerase (Mg2+ plus buffer) RR002M 250 Units ناموجود TaKaRa
96 TaKaRa EX Taq Hot Start 250 units RR006A None ناموجود TaKaRa
97 TaKaRa EX Taq Hot Start 20 units RR006Q-20U None ناموجود TaKaRa
98 PrimeScript RT-PCR Kit RR014A Kit ناموجود TaKaRa
99 TaKaRa Ex Taq Mg2+ free buffer RR01AM 250u ناموجود TaKaRa
100 Real Time one step RNA PCR kit, Version 2 RR026 100 Test ناموجود TaKaRa
101 cDNA Kit TaKaRa RR037A 200 react ناموجود TaKaRa
102 cDNA Kit TaKaRa-100rxns RR037A-100rxns None ناموجود TaKaRa
103 cDNA Kit TaKaRa-50rxns RR037A-50rxns None ناموجود TaKaRa
104 PrimeScript RT reagent Kit (PRT) 20 test RR037Q 20 react ناموجود TaKaRa
105 TaKaRa LA Taq HS (dNTP inclus) RR042Q None ناموجود TaKaRa
106 One Step RT-PCR Kit Ver. 2 RR055A 50 react ناموجود TaKaRa
107 Multiplex PCR Assay Kit Ver.2 RR062A 100 Rxns ناموجود TaKaRa
108 One Step PrimeScript RT_PCR Kit 100 react. RR064A 100 react ناموجود TaKaRa
109 SpeedSTAR Taq 50 units RR070Q 50 Units ناموجود TaKaRa
110 One Step SYBRPrime Script RT-PCR 100react TaKaRa RR086A 100 react ناموجود TaKaRa
111 SYBR® Premix DimerEraser™ (Perfect Real Time) RR091A 200 Rxns ناموجود TaKaRa
112 EmeraldAmp GT PCR Master Mix TaKaRa 160t RR310A 4ml ناموجود TaKaRa
113 EmeraldAmp GT PCR Master Mix TaKaRa 40t RR310Q 1ml ناموجود TaKaRa
114 EmeraldAmp Max PCR Master Mix RR320A 4ml ناموجود TaKaRa
115 EmeraldAmp Max PCR Master Mix RR320Q 1ml ناموجود TaKaRa
116 EmeraldAmp Max HS PCR Master Mix RR330A 4ml ناموجود TaKaRa
117 EmeraldAmpMaxHS PCR Master Mix - (RR330A) RR330A 4ml ناموجود TaKaRa
118 EmeraldAmp MAX HS PCR master mix RR330Q 1 ml  ناموجود TaKaRa
119 SapphireAmp Fast PCR Master Mix160Test Takara RR350A 4 ml ناموجود TaKaRa
120 SapphireAmp Fast PCR Master Mix 40 Reaction Takara RR350Q 1 ml ناموجود TaKaRa
121 Premix Ex Taq (Probe qPCR) RR390L 5ml ناموجود TaKaRa
122 SYBR Premix Ex Taq2 (Tli Rnase H Plus) 200T RR820L 5ml ناموجود TaKaRa
123 SYBR Premix Ex Taq2 (Tli Plus) 25ml RR820W 25ml ناموجود TaKaRa
124 Mini gene synthesis 181bp with subcloning pUC57 Rabies V None ناموجود BioBasic
125 RetroNectin® Recombinant Human Fibronectin Fragment T100A 0.5 mg ناموجود TaKaRa
126 Retro Nectin T100B None ناموجود TaKaRa
127 RetroNectin® Pre-coated Dish T110A plates ناموجود TaKaRa
128 Mini gene synthesis 233bp with subcloning pUC57 TGEV None ناموجود BioBasic
129 TACCAAGAGAACTACATATCCGATGACCTTCCGTGGGGCCTAGTAGTTGCGGGACTACTAGACACTGTATGA apte zia-72bp None ناموجود BioBasic
130 oligo 32bp OD2 HPLC Purification 5`SH C6 oligo32bp None ناموجود BioBasic
131 Millieu de transfection des Plasmides sc-108062 None ناموجود Santa Cruz
132 Réactif de Transfection Ultracruz® sc-395739 None ناموجود Santa Cruz
133 Plasmide de Contrôle CRISPR/Cas9 sc-418922 None ناموجود Santa Cruz
134 AAUAAAGCGUUCUGUCAACC 20bp OD5 HPLC Purification siRNA1 None ناموجود BioBasic
135 GGAUGCUAUUGUGAAUGUGTT 21bp OD5 HPLC Purification siRNA3b None ناموجود BioBasic
136 سنتز ژن subcloning PUC57-803bp سنتز ژن subcloning P 804bp ناموجود BioBasic