لیست محصولات

×

آیا سوالی دارید؟ با ما تماس بگیرید.تلفن: (021)44260285(4 خط) - تلگرام: +989391127651

×

اگر درخواست های شما در قالب یک فایل هستند یا سفارش خاصی مدنظر دارید، دکمه رو به رو را کلیک کنید.

محصولات موجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 فيلتر سرسرنگي 0.22 استریل تک عددي عدد 180,000 MS
2 perl 450,000 None
3 Nitric Acid 2.5lit 4,500,000 Scharlau
4 صفحه مخصوص لام 250,000 None
5 Copper Nitrate 250gr 2,500,000 Acros
6 مگنت سایز 2 65,000 None
7 پتري ديش 3.5 کشت سلول استريل عدد 350,000 Jetbiofil
8 پليت 4خانه نچسب استريل عدد 300,000 Jetbiofil
9 فيلتر سرسرنگي 0.45 استریل تک عددي عدد 180,000 MS
10 Rox I 40 ul 1,200,000 TaKaRa
11 Ammonium Sulfate 100G 1,800,000 Acros
12 پرل شيشه ايي-250gr 250g 950,000 ایرانی
13 رک نوک کريستالي خالي عدد 450,000 چینی
14 شيشه رنگ آميزي لام 350,000 None
15 رک نوک زرد همراه نوک 450,000 چینی
16 استراپر 250,000 None
17 Serafol 2,500,000 Serafol
18 پليت ته صاف 96 خانه استريل ST plate 55,000 None
19 دي سديم هيدروژن فسفات 1Kg Acros - None 3,950,000 Acros
20 Rox II - 100µl 1,100,000 TaKaRa
21 پليت 12 خانه استريل - None 190,000 SPL
22 Buffer BSA 1000 1ml 600,000 TaKaRa
23 Buffer Triton X100 1000 1ml 600,000 TaKaRa
24 Buffer H 1000 None 600,000 TaKaRa
25 Apa I 1005A 10000u 9,950,000 TaKaRa
26 BOD Cell Test (BSB) 1.00687.0001 50 T 9,800,000 Merck
27 Bgl I 1000 units 1020A 1000U 4,500,000 TaKaRa
28 Dra I AhaIII 4000u TakaRa 1037A 4000u 9,950,000 TaKaRa
29 Mbo I 1069A 1000u 7,500,000 TaKaRa
30 Paraffin 107300 1kg 4,500,000 Merck
31 Hydroxyurea 10872383-1G 1g 3,950,000 Molekula
32 EcoT22I (AvaIII) 1125A 2000 u 9,500,000 TaKaRa
33 BspT104 (Asu II, Nsp V) 1225A 2500 u 7,950,000 TaKaRa
34 Sodium Carbonate 131648 1kg 2,950,000 Panreac
35 Vindoline 13940871-5MG None 5,950,000 Molekula
36 Syringic acid 14539311-10g 10g 4,950,000 Molekula
37 Syringic acid 14539311-1g 1g 1,500,000 Molekula
38 Syringic acid 14539311-25g 25g 9,500,000 Molekula
39 Syringic acid 14539311-50g 50g 15,500,000 Molekula
40 Salicylic acid 17820272-1KG 1kg 6,950,000 Molekula
41 Sillicon Cloride-500ml 201165000 500ml 8,950,000 Acros
42 Ribonuclease H (RNase H) 1000units TaKaRa 2150A 1000U 8,950,000 TaKaRa
43 Imidazole 21611083-100g 100g 4,950,000 Molekula
44 Dodecyl-beta-D-maltoside (DDM) 21771928-1G 1g 6,950,000 Molekula
45 ميکرو تيوب 0.2 Rnse Free بسته 1000عددي Orange 25500 None 2,950,000 Orange
46 BcaBEST DNA Polymerase 300U 2770Q 300u 2,950,000 TaKaRa
47 pUC 19 DNA 3219 None 12,500,000 TaKaRa
48 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-10g 10g 2,950,000 Molekula
49 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-50g 50g 7,950,000 Molekula
50 100 bp DNA ladder 3407A 100 Rxns 16,950,000 TaKaRa
51 500 bp DNA ladder 3411A 50 µg 16,950,000 TaKaRa
52 Poly(vinyl alcohol)-25gr 363065-25G 25g 9,500,000 Sigma
53 4-Imidazolecarboxylic acid 425842 1gr 19,500,000 Sigma
54 DAB-Am-4,Polypropylenimine tetramine dendrimer, generation 1 460699 5ml 35,000,000 Sigma
55 Curcumin 49256996-1g None 1,950,000 Molekula
56 Curcumin-5g 49256996-5g None 4,500,000 Molekula
57 لوله فالکون 50 استريل RNase & DNase Freeبسته 25عددي 50050 None 975,000 SPL
58 ABTS (2.2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)diammonium salt) 51808824-1G 14,950,000 Molekula
59 Resveratrol 51852282-100MG None 4,500,000 Molekula
60 Tannic acid 52612564-100G 100g 3,500,000 Molekula
61 Tannic acid 52612564-250G 250g 6,500,000 Molekula
62 Tannic acid 52612564-50G 50g 2,500,000 Molekula
63 Resazurin sodium salt 56554686-1G 1g 3,950,000 Molekula
64 Fluorescamine 57916662-100MG 100mg 8,950,000 Molekula
65 Tet System Approved FBS 631107-50ML None 19,800,000 TaKaRa
66 Universal GenomeWalker 2.0 636405 None 180,000,000 TaKaRa
67 SeqAmp DNA Polymerase 638504 None 22,000,000 TaKaRa
68 CloneAmp HiFi PCR Premix 639298-50rxns None 5,500,000 TaKaRa
69 فلاسک کشت سلول 175cm فيلتردار استريل بسته5 عددي 71175 None 1,425,000 SPL
70 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-5G 2,950,000 Molekula
71 1,3-Dibromopropane 803279-100ml 100ml 12,500,000 Sigma
72 Topotecan hydrochloride 85474031-25MG 25mg 25,000,000 Molekula
73 Quercetin 86015335-1G 1g 14,500,000 Molekula
74 Catharanthine 89985253-5MG None 5,950,000 Molekula
75 SUPREC-01 (Rapid Recovery of DNA from Agarose Gels) 9040 100T 12,500,000 TaKaRa
76 10X Takara Taq Buffer (Mg2+ free) 9151AM-1ML None 1,950,000 TaKaRa
77 2X GC Buffer I 9154-1.5ml None 1,500,000 TaKaRa
78 GC Buffer II 9155 1.25ml 1,500,000 TaKaRa
79 Loading buffer 6X 9156 vials 950,000 TaKaRa
80 Loading buffer 10 X 9157 vials 950,000 TaKaRa
81 Esay Dilution 1 pak 9160 1ml 25,000,000 TaKaRa
82 Plant DNA Isolation Reagent 9194 100T 12,500,000 TaKaRa
83 NucleoCassette™ 941-0002 Pack 29,500,000 NucleoCassette
84 High Reverse Transcriptase (RNase H-, 10000 U) 9K-005-0005-10000U None 39,500,000 BioBasic
85 TBE buffer (Tris-Borate-EDTA), primix powder A0014 1PK 2,500,000 BioBasic
86 TAE buffer 25x solution A0023 1L 4,950,000 BioBasic
87 10X TBE A00269 500ML 1,950,000 BioBasic
88 TBS buffer . 10x Solution A0027-4L None 6,950,000 BioBasic
89 Arsenic(III) oxide A1010 25gr 9,500,000 Sigma
90 دی آمونیوم هیدروژن فسفات A2301 500gr 1,950,000 Applichem
91 Amoxicillin, trihydrate A762203 5gr 2,500,000 BioBasic
92 Abscisic acid (Dormin, ABA) (+) AB0001 100mg 6,950,000 BioBasic
93 Acetylcholine chloride AB0002 5G 2,500,000 BioBasic
94 ADA buffer disodium salt Ab0005-25g None 3,500,000 BioBasic
95 Alizarin yellow GG AB0011 25gr 1,950,000 BioBasic
96 Alizarin yellow R AB0012 25gr 1,950,000 BioBasic
97 Agarose M AB0013 50gr 4,500,000 BioBasic
98 Agarose B, low EEO AB0014 50 gr 5,500,000 BioBasic
99 Alkali blue 6B AB0016 25gr 3,600,000 BioBasic
100 Adenosine 5-triphosphate(ATP) disodium salt AB0020 5g 2,500,000 BioBasic
101 Ammonium bicarbonate AB0032 500gr 2,500,000 BioBasic
102 Ammonium bicarbonate AB0032-100G None 950,000 BioBasic
103 4-Aminoantipyrine AB0033-100G 100G 5,300,000 BioBasic
104 Ammonium bromide AB0057 250gr 2,950,000 BioBasic
105 Ammonium carbonate AB0058 500gr 2,550,000 BioBasic
106 Ammonium citrate, dibasic AB0059 500gr 3,300,000 BioBasic
107 Ammonium citrate, tribasic AB0060 250gr 2,250,000 BioBasic
108 Ampicillin, trihydrate AB0064-1G None 950,000 BioBasic
109 Ampicillin, trihydrate AB0064-5G None 2,500,000 BioBasic
110 Ammonium iron(II) sulfate hexahydrate AB0065 500gr 3,500,000 BioBasic
111 Ammonium molybdate tetrahydrate AB0067 50gr 1,500,000 BioBasic
112 Ammonium oxalate hydrate Ab0070-500g None 5,500,000 Molekula
113 D-Arabinose AB0071D 25G 4,500,000 BioBasic
114 L-Arabinose AB0071L 25gr 5,500,000 BioBasic
115 Ammonium phosphate, tribasic trihydrate AB0073 500G 2,500,000 BioBasic
116 Anthraquinone AB0087 25G 2,500,000 BioBasic
117 Anthrone AB0088 25gr 4,500,000 BioBasic
118 Anthrone AB0088-5g 1,500,000 BioBasic
119 L-Aspartic acid AB0091 250G 2,500,000 BioBasic
120 L-Arginine free base AB0205 100g 4,500,000 BioBasic
121 L-Arginine, monohydrochloride AB0206 500g 13,500,000 BioBasic
122 L-Arginine, monohydrochloride AB0206 100g 3,950,000 BioBasic
123 Acetamide AB0687-100g None 1,950,000 BioBasic
124 Acetosyringone AB1111 1g 7,500,000 BioBasic
125 N-Acetyl-D-glucosamine AB2245 25gr 2,500,000 BioBasic
126 Acriflavine hydrochloride AB4433 25G 3,950,000 BioBasic
127 N-Acetyl-L-Cysteine AB6697-5g None 1,950,000 BioBasic
128 Aniline AC1710 100ML 5,400,000 BioBasic
129 ABTS , di ammonium salt AD0002 1gr 7,500,000 BioBasic
130 ADA buffer AD0003-25g None 2,950,000 BioBasic
131 ACES Ad0004-25g None 2,950,000 BioBasic
132 Acriflavine, neutral AD0009 25G 3,500,000 BioBasic
133 Adenine AD0013 25gr 2,950,000 BioBasic
134 L-Alanine AD0022 100gr 3,950,000 BioBasic
135 L-Alanine .SIZE.10G AD0022-10G 10g 950,000 BioBasic
136 L-Alanine .SIZE.25G AD0022-25G 25g 1,950,000 BioBasic
137 L-Alanine .SIZE.50G AD0022-50G 50g 2,950,000 BioBasic
138 Adenine sulphate, dihydrate AD0028 25G 3,200,000 BioBasic
139 Amphotericin B AD0030P 1g 4,500,000 BioBasic
140 BSA Standard, 0.5mg/ml AD0069 2ml 1,500,000 BioBasic
141 Alizarin red S AD0144 25gr 2,950,000 BioBasic
142 Ammonium acetate ADB0032 500gr 2,250,000 BioBasic
143 Ammonium chloride ADB0034 500gr 1,950,000 BioBasic
144 Ammonium chloride ADB0034-250g None 1,300,000 BioBasic
145 Ammonium phosphate, dibasic ADB0040 500gr 4,350,000 BioBasic
146 Ammonium phosphate,  monobasic ADB0042 500gr 4,350,000 BioBasic
147 BSA Standard Solution AJ642.SIZE.1ML None 1,950,000 BioBasic
148 Ammonium acetate AR0032 500gr 2,550,000 BioBasic
149 AUTOCLAVE INDIcat_numberOR TAPES AT011.1ROLLS 1Rol 3,950,000 BioBasic
150 PFU DNA Polymerase, 5U/UL B0093 100u 5,950,000 BioBasic
151 PFU DNA POLYMERASE, 5U/UL.SIZE.500U B0093(D0090P)-500U None 19,500,000 BioBasic
152 Polyoxyethylene Lauryl Ether-35 (Brij 35) B0217-250G 250G 3,950,000 BioBasic
153 Bismuth (III) citrate B0466 100G 1,950,000 BioBasic
154 T4 DNA LIGASE, 5U/UL.SIZE.200U B1125-200U None 5,500,000 BioBasic
155 Imidazole – 4-carboxaldehyde 97% B25050 5gr 19,500,000 AlfaAesar
156 Bis-acrylamide BB0025 50g 3,950,000 BioBasic
157 Bis-acrylamide BB0025 250gr 17,500,000 BioBasic
158 Bis-acrylamide.SIZE.10G BB0025-10G None 1,300,000 BioBasic
159 Bromothymol blue, free acid BB0043 5G 1,650,000 BioBasic
160 BCIP toluidine salt BB0072 100MG 4,500,000 BioBasic
161 D-Biotin BB0078 1gr 2,500,000 BioBasic
162 Bis-Tris BB0079 25gr 2,500,000 BioBasic
163 Bis-Tris BB0079-100gr 100gr 7,950,000 BioBasic
164 X-Gal BB0083 100mg 2,950,000 BioBasic
165 X-Gal BB0083.SIZE.5G 5gr 45,000,000 BioBasic
166 Bacitracin zinc BB0113 5g 2,950,000 BioBasic
167 B. Extract BB0114-100g 100G 3,200,000 BioBasic
168 Barium acetate BB0116 250G 3,950,000 BioBasic
169 Benzamide BB0122 100gr 2,500,000 BioBasic
170 Benzimidazole BB0125 25gr 1,800,000 BioBasic
171 Berberine chloride BB0129.SIZE.5G None 4,500,000 BioBasic
172 BES, free acid BB0130 25G 2,700,000 BioBasic
173 BES, monosodium salt BB0131 25G 3,850,000 BioBasic
174 Betaine hydrochloride BB0133 250gr 4,950,000 BioBasic
175 Brilliant green BB0242 25gr 1,500,000 BioBasic
176 Bromocresol purple, free acid BB0244 25G 4,950,000 BioBasic
177 Bicine BB0266 100G 4,500,000 BioBasic
178 Bromocresol purple, sodium salt BB0627 5gr 1,500,000 BioBasic
179 6-Benzylamino purine BB0743-25G None 3,950,000 BioBasic
180 Basic fuchsin, certified BB1111 5gr 1,500,000 BioBasic
181 Benzoic acid BB1147 250gr 2,500,000 BioBasic
182 Bromophenol blue BB2230 25g 3,950,000 BioBasic
183 Benzaldehyde BC2140 500G 6,950,000 BioBasic
184 Bromothymol blue, sodium salt BD0048 5G 1,800,000 BioBasic
185 Bromocresol green, free acid BD0159 5G 2,950,000 BioBasic
186 1-Butanesulfonic acid sodium salt BD1237 5G 3,950,000 BioBasic
187 Bromophenol blue, sodium salt BDB0001 25g 4,500,000 BioBasic
188 تیوب 0.2میلی لیتر پی سی آر ، با درب صاف ،استریل،10 Rnase/DNase Free بسته 1000 BP541-S100 بسته 4,500,000 BioBasic
189 تیوب 0.2میلی لیتر پی سی آر ، با درب محدب ،استریل،10 Rnase/DNase Free بسته 1000 عددی BP542-S100 بسته 4,500,000 BioBasic
190 96 Well 2ml Deep Plate, Natural, Edge Filled, 10 P BR581-96N None 3,950,000 BioBasic
191 96 Well 2ml Deep Plate, Natural, Edge Filled, BR581-96N None 450,000 BioBasic
192 96 Well 2ml Deep Plate, Natural, Edge Filled, Sterile, 10 P BR581-96NS 96NS 4,950,000 BioBasic
193 EZ-10 Spin Column Total RNA Mini-preps Kit BS1361 50preps 9,950,000 BioBasic
194 DNA Blunting & Ligation Kit BS243-10 Preps None 7,950,000 BioBasic
195 EZ-10 Spin Column DNA Gel Extraction Kit BS353 50 preps 6,500,000 BioBasic
196 EZ-10 Spin Column DNA Gel Extraction Kit BS354 100 preps 9,950,000 BioBasic
197 EZ-10 Spin Column PCR names Purificat_numberion Kit BS363 50preps 6,500,000 BioBasic
198 EZ-10Spin Column PCR Products Purification Kit 100preps BS364-100preps None 9,950,000 BioBasic
199 Mammalian Protease Inhibitor Cocktail, 100x Strength Solution BS386 1ml 19,950,000 BioBasic
200 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS413 50preps 6,500,000 BioBasic
201 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS414 100 preps 9,950,000 BioBasic
202 EZ-10 Spin Column animal DNA Mini-Preps Kit BS427 50preps 6,950,000 BioBasic
203 PCR Product Cloning Kit BS435-20 preps None 8,500,000 BioBasic
204 PCR Product Cloning Kit BS436-100PREPS None 32,000,000 BioBasic
205 Fast DNA Ligation Kit(5U/UL,T4) 10RXN BS511-10RXN None 4,500,000 BioBasic
206 EZ-10 Spin Column Total RNA Mini-Preps Super Kit BS583 20preps 5,950,000 BioBasic
207 Penicillin / Streptomycin / Amphotericin B, sterile BS733 10ml 1,100,000 BioBasic
208 EZ-DNA Reagents BS8202 100 Preps 8,950,000 BioBasic
209 EZ-10 Spin Column Animal Total RNA Mini-Preps Kit BS82312 50 preps 9,950,000 BioBasic
210 EZ-10 Spin Column Blood RNA Mini-Preps Kit BS82313 50preps 13,500,000 BioBasic
211 EZ-10 Spin Column Plant RNA Mini-Preps Kit BS82314 50preps 13,500,000 BioBasic
212 EZ-10 Spin Column Yeast DNA Mini-Preps Kit BS8257 50 PREPS 9,950,000 BioBasic
213 Rapid Bacteria RNA Isolation Kit BS8625 50preps 6,950,000 BioBasic
214 All-In-one DNA/RNA/Protein Miniprep Kit BS88003 50preps 18,500,000 BioBasic
215 EZ-10 DNAaway RNA Mini-Preps Kit BS88133-50 PREPS None 18,500,000 BioBasic
216 All-In-One DNA/RNA Miniprep Kit BS88203 50preps 16,500,000 BioBasic
217 One-4-ALL Genomic DNA Miniprep Kit BS88503 50preps 15,500,000 BioBasic
218  EZ-10 Total RNA Miniprep Kit BS88583 50preps 13,500,000 BioBasic
219 EZ-10 Spin Column RNA Cleanup & Concentration Kit.SIZE.50 Pre BS91315-50prep 50Prep 11,500,000 BioBasic
220 Membrane,Nuclear & CyToplasmic Protein Extraction Kit BSP002 50preps 13,950,000 BioBasic
221 One Step Plant Active Protein Extraction Kit BSP004-20PREPS None 12,000,000 BioBasic
222 TCA Protein Precipitation Kit BSP011-50 Preps None 5,950,000 BioBasic
223 Universal Protein Sediment Reagent BSP012-100 Preps None 5,950,000 BioBasic
224 Bacterial Protein Lysis Buffer, 1x Stength Solution BSP023-25ML None 4,500,000 BioBasic
225 رک سرسمپلرکریستالی کوتاه (10-1/0 میکرو لیتر)استریل رک 96 عددی BT215-RS رک 96 عددی 580,000 BioBasic
226 رک سرسمپلرکریستالی متوسط (10-2/0 میکرو لیتر)استریل رک 96 عددی Rnase/DNase Free BT216-RS رک 96 عددی 580,000 BioBasic
227 سرسمپلرکریستالی متوسط (10-2/0 میکرو لیتر)استریل Rnase/DNase Free BT216-S 1000pcs 1,800,000 BioBasic
228 سرسمپلر آبی 1000-100میکرولیتر استریل-بسته 1000 عددی Rnase/DNase Free BT222-BS بسته 2,950,000 BioBasic
229 رک سر سمپلر آبی (100-1000) رک 100 خانه استریل RNase & DNase Free BT222-RS رک 100عددی 750,000 BioBasic
230 رک سر سمپلر زرد (200 میکرو لیتر) مدرج استریل Rnase/DNase Free BT224-RS , Rack BT224-RNS رک 96 عددی 600,000 BioBasic
231 سر سمپلر زرد (200 میکرو لیتر)مدرج استریل Rnase/DNase Free بسته هزار عددی BT224-YS بسته هزار عددی 1,950,000 BioBasic
232 رک سرسمپلرکریستالی (10-5/0 میکرو لیتر)استریل رک 96 عددی Rnase/DNase Free BT225-RS رک 96 عددی 580,000 BioBasic
233 سرسمپلرکریستالی بلند (10-5/0 میکرو لیتر)استریل بسته هزار عددی Rnase/DNase Free BT225-S 1000pcs 1,800,000 BioBasic
234 تیوب 65/0 میلی لیتر استریل ، بسته 1000 عددی Rnase/DNase Free BT613-NS 1000pcs 2,950,000 BioBasic
235 تیوب 2 میلی لیتر ته مخروطی استریل  Rnase/DNase Free بسته 1000 عددی BT619-NS 1000pcs 3,950,000 BioBasic
236 تیوب 1/5 میلی لیتر بدون رنگ دارای بسته بندی 1000تایی و استریل Rnase/DNase Free BT620-NS بسته 3,950,000 BioBasic
237 1.5ML Tube, Natural, Sterile, /Bag 100 BT620-NS-100Pak None 420,000 BioBasic
238 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G-100ul None 2,300,000 BioBasic
239 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G-200ul None 3,950,000 BioBasic
240 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G.500ul None 8,950,000 BioBasic
241 Caffeine C0150 100gr 3,500,000 BioBasic
242 Citric acid, monohydrate C2123 500gr 2,850,000 BioBasic
243 CAPS C2632 100gr 8,500,000 Sigma
244 Sodium citrate, trisodium salt, dihydrate CB0035 500gr 2,500,000 BioBasic
245 Coomassie brilliant blue R-250    CB0037 5gr 2,500,000 BioBasic
246 Coomassie brilliant blue R-250.SIZE.1G CB0037-1G None 1,100,000 BioBasic
247 Coomassie brilliant blue G-250 CB0038-100G 100G 19,950,000 BioBasic
248 Coomassie brilliant blue G-250 CB0038-25G 25G 6,500,000 BioBasic
249 Coomassie brilliant blue G-250 CB0038-5G 5G 2,500,000 BioBasic
250 Calcium carbonate, anhydrous CB0052 500gr 2,500,000 BioBasic
251 L-Cystine CB0088-100G 100G 4,500,000 BioBasic
252 Cetyldimethylethyl ammonium bromide CB0105 100gr 4,500,000 BioBasic
253 CTAB .SIZE.25G CB0108-25G 25g 1,950,000 BioBasic
254 CHES CB0115 50gr 3,200,000 BioBasic
255 Chloramphenicol CB0118 50gr 4,500,000 BioBasic
256 Chloramphenicol CB0118 250gr 17,500,000 BioBasic
257 Chloramphenicol CB0118-10G None 1,500,000 BioBasic
258 L-Cysteine CB0132-500g None 16,950,000 BioBasic
259 L-Cysteine hydrochloride, monohydrate CB0133 100gr 3,300,000 BioBasic
260 L-Cysteine hydrochloride. monohydrate CB0133-500 None 14,000,000 BioBasic
261 Calcium acetate monohydrate CB0249 250gr 2,950,000 BioBasic
262 Calcium Hydroxide CB0256 500gr 3,950,000 BioBasic
263 Calcium nitrate. tetrahydrate CB0258-500g None 2,950,000 BioBasic
264 Calcium phosphate, dibasic, dihydrate CB0262 500gr 3,500,000 BioBasic
265 Calcium phosphate, tribasic CB0263 250gr 2,250,000 BioBasic
266 Calcium sulfate, dihydrate CB0265 500gr 3,850,000 BioBasic
267 L-Carnitine (Vitamin BT ) CB0272 25gr 3,950,000 BioBasic
268 D-(+) Cellobiose CB0278 5gr 6,500,000 BioBasic
269 4-Chloro-1-naphthol CB0293 10gr 3,950,000 BioBasic
270 Chlortetracycline, hydrochloride CB0297 25gr 4,200,000 BioBasic
271 Cholic acid CB0298-50g None 5,950,000 BioBasic
272 Choline chloride CB0299 100G 3,200,000 BioBasic
273 Ciprofloxacin hydrochloride CB0310 25g 3,850,000 BioBasic
274 Colchicine CB0322 100mg 4,950,000 BioBasic
275 Congo Red CB0324 50gr 3,500,000 BioBasic
276 Creatine hydrate CB0326 100G 2,950,000 BioBasic
277 Creatinine CB0328 5gr 1,500,000 BioBasic
278 Creatinine CB0328-25G 25G 3,500,000 BioBasic
279 Crystal violet CB0331 25gr 1,950,000 BioBasic
280 CTAC , Cetyltrimethy lammonium chloride CB0332 100gr 3,950,000 BioBasic
281 CTAC, Cetyltrimethylammonium chloride CB0332-25g 25g 1,500,000 BioBasic
282 a-Cyclodextrin hydrate CB0348-5G 4,500,000 BioBasic
283 Cyclosporin A CB0352 250mg 3,950,000 BioBasic
284 STEM-CELLBANKER GMP grade-20ml CB046 20ml 4,950,000 TaKaRa
285 CELLOTION CB051  100ml 4,950,000 TaKaRa
286 Chitosan CB0660 500G 23,000,000 BioBasic
287 4-Chlorophenoxyacetic acid CB0720 100G 2,950,000 BioBasic
288 4-Chlorophenoxyacetic acid sodium salt CB0721 100G 2,950,000 BioBasic
289 Copper (II) acetate hydrate CB3050 100G 2,950,000 BioBasic
290 Casamino Acids CB3060 100gr 3,500,000 BioBasic
291 CASAMINO ACID CB3060-25g None 1,100,000 BioBasic
292 Copper (II) chloride hydrate CB3090 250G 3,600,000 BioBasic
293 Cresol red , sodium salt CD0037C 5gr 1,950,000 BioBasic
294 Calcium chloride, dihydrate CD0050-500G 500gr 3,500,000 BioBasic
295 CHAPS CD0110 1gr 1,950,000 BioBasic
296 CHAPSO CD0113 1gr 2,950,000 BioBasic
297 Copper (II) sulfate pentahydrate CDB0063 500G 4,500,000 BioBasic
298 Copper (II) sulfate pentahydrate CDB0063-100G 100g 1,500,000 BioBasic
299 Carbenicillin disodium CDJ469-1g None 9,500,000 BioBasic
300 10/200mm Communis Chromatography ColUMns CH001.SIZE.1 5,400,000 BioBasic
301 10/300mm Communis Chromatography Columns CH002 10/30mm 5,950,000 BioBasic
302 10/400mm Communis Chromatography Columns CH003 10/400mm 6,950,000 BioBasic
303 10/500mm Communis Chromatography Columns CH004 10/500mm 7,500,000 BioBasic
304 16/200mm Communis Chromatography Columns CH007 16/200mm 6,950,000 BioBasic
305 16/300mm Communis Chromatography Columns CH008 16/300mm 7,950,000 BioBasic
306 CARRAGEENAN CN1138 500G 6,750,000 BioBasic
307 Calcium chloride, anhydrous CT1330 500G 3,600,000 BioBasic
308 Calcium chloride, anhydrous CT1330-250g None 2,200,000 BioBasic
309 Agarose A D0012-50g 50g 4,500,000 BioBasic
310 TSG DNA Polymerase, 5U/UL D0081 200u 3,500,000 BioBasic
311 Dimethyl sulfoxide (DMSO) D0231 500ml 3,950,000 BioBasic
312 Glyoxal, 40% solution D0238 1KG 4,950,000 BioBasic
313 Dialysis tubing cellulose membrane23mm غشاء دیالیز با قطر 23mm (Molecular weight cut-off : 12400Da) D0405 Meter 1,800,000 Sigma
314 Dialysis tubing cellulose membrane32mm غشاء دیالیز با قطر 32mm (Molecular weight cut-off : 12400Da) D0530 Meter 1,800,000 Sigma
315 Dialysis tubing cellulose membrane10mm غشاء دیالیز با قطر 10mm (Molecular weight cut-off : 14KDa) D9277 Meter 1,800,000 Sigma
316 Dialysis tubing cellulose membrane43mm غشاء دیالیز با قطر 43mm (Molecular weight cut-off : 14KDa) D9527 Meter 1,800,000 Sigma
317 2'-Deoxythymidine DB0049 1gr 1,950,000 BioBasic
318 DTT DB0058 5gr 7,950,000 BioBasic
319 DTT .SIZE.1G DB0058-1g None 3,500,000 BioBasic
320 DTNB DB0113 5gr 12,500,000 BioBasic
321 DEAE, Dextran HCl-Form DB0147 10G 4,200,000 BioBasic
322 DEPC DB0154 5ml 4,500,000 BioBasic
323 DEPS DB0154-1ml None 1,950,000 BioBasic
324 2,4-Dichlorophenoxy acetic acid DB0166 100G 2,950,000 BioBasic
325 DNA & RNase Away™ DB0339 200ml 4,200,000 BioBasic
326 N-N-Dimethylglycine hydrochloride DB0412 25gr 1,950,000 BioBasic
327 DTAB,dodecyltrimethyl ammonium bromide DB0431-50G 50g 4,500,000 BioBasic
328 Sodium azide DB0613 100gr 3,950,000 BioBasic
329 Diethylamine DC3320 500ML 7,950,000 BioBasic
330 dNTP mixture (10mM) DD0056 0.5ml 2,950,000 BioBasic
331 DIPSO free acid DD0166D 25G 3,300,000 BioBasic
332 2,7-Dichlorofluorescein DD1220 5G 3,950,000 BioBasic
333 Dimethylglyoxime sodium salt DD1221-100G 100g 2,950,000 BioBasic
334 Denaturing solution DE540 1L 2,950,000 BioBasic
335 Decyl-beta-D-glucopyranoside DJ574 100MG 2,950,000 BioBasic
336 DNAfectamine DNAF001-0.3ML None 16,950,000 BioBasic
337 Silica gel with moisture indicator DSG110-1KG None 3,750,000 BioBasic
338 Silica Gel Dryer DSG111-1PK None 2,950,000 BioBasic
339 Eco Green-DNA Dye ,ready to use 1.5ml DT81414-1.5ml 1.5ml 14,950,000 BioBasic
340 Eco-Red-DNA Dye . Ready to use DT81415-1 ML 1ML 9,950,000 BioBasic
341 Eco-Stain Plus . ready to use DT81418-1 ML 1ML 16,950,000 BioBasic
342 EDTA , free acid EB0107 500gr 3,500,000 BioBasic
343 Erythromycin EB0192 25gr 7,500,000 BioBasic
344 EDTA , Iron (III), sodium salt EB0437 100gr 3,500,000 BioBasic
345 Eosin Y, sodium salt EB0441 25G 1,950,000 BioBasic
346 Erythritol EB0444 100G 4,300,000 BioBasic
347 esculin, hydrate EB0452 5G 5,500,000 BioBasic
348 EDTA zinc (II), disodium salt EB6666 100G 3,300,000 BioBasic
349 EGTA ED0077 25g 5,950,000 BioBasic
350 Bromocresol green, sodium salt ED0087 5gr 2,950,000 BioBasic
351 Eosin Y, free acid EE0190 25gr 1,950,000 BioBasic
352 Eosin Y . free acid EE0190-100g None 4,950,000 BioBasic
353 Freund’s Adjuvant, InComplete F5506 10ml 9,500,000 Sigma
354 Freund’s Adjuvant, Complete F5881 10ml 9,500,000 Sigma
355 Agar A FB0010-500G 500G 9,500,000 BioBasic
356 Agar B FB0012 100gr 2,700,000 BioBasic
357 Agar B FB0012 500G 9,950,000 BioBasic
358 Fluorescein, disodium salt FB0203 100G 2,950,000 BioBasic
359 Formamide deionized FB0211 100ml 2,950,000 BioBasic
360 D(-)-Fructose FB0213 500gr 1,950,000 BioBasic
361 Iron(II) sulfate . heptahydrate FB0461-500g None 3,950,000 BioBasic
362 Fluorescein, free acid FB0463 100G 2,950,000 BioBasic
363 Folic acid (Vitamin M) FB0466 25gr 8,500,000 BioBasic
364 Folic acid (Vitamin M) FB0466-5g None 4,950,000 BioBasic
365 5-Fluorouracil FD0080 5gr 3,950,000 BioBasic
366 Fluorene FD1223 50gr 2,950,000 BioBasic
367 سرسمپلر فیلتردار شفاف 10- 1/0میکرولیتر بسته 1000 عددی FT215 1000pcs 4,950,000 BioBasic
368 سرسمپلر فیلتردار شفاف –سایز 1000-100میکرولیتر بسته 1000 عددی FT222 1000pcs 5,500,000 BioBasic
369 رک سرسمپلر فیلتردار( 1000-100میکرولیتر) استریل رک 100 عددی  Rnase/DNase Free FT222-RS رک 100 خانه 980,000 BioBasic
370 رک سر سمپلر کریستالی فیلتردار(10-5/0میکرولیتر) استریل رک 96 عددی  Rnase/DNase Free FT225-RNS رک 96 عددی 800,000 BioBasic
371 Rapid Fungal DNA Isolation Kit FT71415 50preps 5,950,000 BioBasic
372 Rapid Fungal RNA Extraction Kit FT71416 50preps 6,950,000 BioBasic
373 Glucose oxidase G0243 50KU 11,000,000 BioBasic
374 Yeast Extract G0961 500gr 6,500,000 BioBasic
375 AGAR C G1253 100gr 1,950,000 BioBasic
376 Tryptone Powder G211(TG217) 100gr 2,500,000 BioBasic
377 Peptone E Gelatin Peptone G212 100gr 2,950,000 BioBasic
378 Peptone A From Meat G213 500G 7,950,000 BioBasic
379 Peptone A From Meat G213  100gr 1,950,000 BioBasic
380 Peptone B SOY Protein G214-100G 100G 2,500,000 BioBasic
381 Peptone D Protease Peptone G241 100gr 2,500,000 BioBasic
382 Peptone D Protease Peptone G241 500G 8,950,000 BioBasic
383 Agar D, Purified Agar G243 100G 5,500,000 BioBasic
384 Peptone F Lactalbumin Hydrolysate G256-100G None 2,500,000 BioBasic
385 PolyPeptone G258 100G 3,500,000 BioBasic
386 Peptone C Peptonized Milk G292 100G 1,950,000 BioBasic
387 Peptone C Peptonized Milk G292 500G 5,950,000 BioBasic
388 Glass beads G8772 10gr 4,800,000 Sigma
389 D(+)Galactose GB0215 100gr 4,950,000 BioBasic
390 Gentamycin sulfate   GB0217 1gr 1,500,000 BioBasic
391 Gentamycin sulfate GB0217 5gr 3,950,000 BioBasic
392 L-Glutamic acid GB0221 500gr 5,500,000 BioBasic
393 L-Glutamic acid GB0221-100g None 2,500,000 BioBasic
394 L-Glutamine GB0224 100gr 3,500,000 BioBasic
395 L-Glutamine GB0224-500G None 13,500,000 BioBasic
396 Glycerol GB0232 500ml 3,300,000 BioBasic
397 Glycerol SIZE.400ML GB0232-400ml None 2,850,000 BioBasic
398 glycine GB0235 2.5K 18,500,000 BioBasic
399 glycine GB0235 500 gr 4,950,000 BioBasic
400 Glycine.SIZE.100G GB0235-100G 100G 1,950,000 BioBasic
401 Guanosine-5'-triphosphate [GTP], 100 mM solution GB0332 0.25ml 4,350,000 BioBasic
402 Gallic acid GB0476 250g 5,500,000 BioBasic
403 Gallic acid GB0476-100G None 2,950,000 BioBasic
404 Giemsa stain    GB0477 10gr 2,500,000 BioBasic
405 Glucose-6-phosphate, disodium salt, hydrate GB0481-1g None 4,950,000 BioBasic
406 Guanine GD0246 25gr 2,500,000 BioBasic
407 Guanosine GD0250 25gr 2,950,000 BioBasic
408 G 418 sulfate GDJ958 100mg 2,950,000 BioBasic
409 ECL™ Western Blotting Detection GERPN2209 Kit 16,500,000 None
410 DNA Marker H2 50,100,150,200,250,300,400,500,600,700,800 900 GM345.SIZE.50 load None 5,950,000 BioBasic
411 HEPES, free acid HB0264 50gr 3,500,000 BioBasic
412 HEPES, free acid HB0264 250gr 9,950,000 BioBasic
413 HEPES free acid HB0264-1KG 1Kg 36,000,000 BioBasic
414 HEPES, sodium salt HB0265 50g 3,950,000 BioBasic
415 HEPES, sodium salt HB0265-250G None 11,000,000 BioBasic
416 L-Histidine, hydrochloride.SIZE.100G HB0330-100G None 3,950,000 BioBasic
417 L-Histidine, hydrochloride.SIZE.25G HB0330-25g None 1,100,000 BioBasic
418 Histamine dihydrochloride HB0501.SIZE.25G None 8,950,000 BioBasic
419 Histamine diphosphate HB0502 5gr 2,950,000 BioBasic
420 HOBT 1-Hydroxybenzotriazole monohydrate HB0511.SIZE.50G None 6,950,000 BioBasic
421 N-Hydroxysuccinimide-5G HB0526-5G None 1,500,000 BioBasic
422 8-Hydroxyquinoline (8-Quinolinol) HD0274-25g None 3,500,000 BioBasic
423 L-Histidine, monohydrochloride, monohydrate HE806 25gr 3,950,000 BioBasic
424 L-Histidine, monohydrochloride, HE806-10G 10g 2,200,000 BioBasic
425 L-Histidine, monohydrochloride, HE806-5G None 1,400,000 BioBasic
426 ممبران استات سلولز بسته 100 عددی13 MM,0.45UM, 100/Box HP131 Pack 3,950,000 BioBasic
427 ممبران استات سلولز بسته 100 عددی 25 MM,0.45UM, 100/Box HP132 Pack 4,500,000 BioBasic
428 ممبران استات سلولز بسته 100 عددی 50 MM,0.45UM,100/Box HP133 Pack 4,950,000 BioBasic
429 5X All-In-One RT MasterMix (50ul) HRT025-10.25RXNS None 6,950,000 BioBasic
430 5X All-In-One RT MasterMix (200ul) HRT100-10.100RXNS None 19,500,000 BioBasic
431 5X All-In-One RT MasterMix (400ul) HRT200-10.SIZE.200 None 32,500,000 BioBasic
432 Taq DNA Polymerase (High PURITY), 5U/UL HTD0078 200u 6,500,000 BioBasic
433 TAQ DNA POLYMERASE-500U HTD0078 None 3,950,000 BioBasic
434 Taq DNA Polymerase (High PURITY), 5U/UL HTD0078 200u 1,950,000 BioBasic
435 4-Isothiocyanatophenyl α-D-Mannopyranoside I905135 95,000,000 TRC
436 رک 38 خانه میکروتیوب 1/5 سرماساز IB002A رک 38 عددی 1,950,000 BioBasic
437 IPTG IB0168 1gr 2,950,000 BioBasic
438 IPTG IB0168 5gr 9,950,000 BioBasic
439 INT dye IB0280 250mg 2,950,000 BioBasic
440 Indigo carmine  IB0532 10gr 1,950,000 BioBasic
441 D-myo-Inositol IB0536 100gr 3,950,000 BioBasic
442 Iodine IB0538 100gr 5,950,000 BioBasic
443 3-Indoleacetic acid (IAA) IB0723 25gr 3,950,000 BioBasic
444 3-Indole-acetic acid sodium salt IB0724 25gr 13,500,000 BioBasic
445 L-Isoleucine IB0914 50G 3,950,000 BioBasic
446 L-Isoleucine IB0914-250G 250g 12,500,000 BioBasic
447 Kanamycin sulfate KB0286 100G 29,500,000 BioBasic
448 Kanamycin sulfate KB0286 5g 2,950,000 BioBasic
449 Kanamycin sulfate 1g KB0286-1G None 950,000 BioBasic
450 Kanamycin sulfate 700mg KB0286-700mg None 850,000 BioBasic
451 Kinetin KB0745 25gr 5,500,000 BioBasic
452 Kinetin KB0745 100G 19,500,000 BioBasic
453 2-Ketoglutaric acid KD0290 100gr 4,500,000 BioBasic
454 Lysostaphin  from  Staphylococcus  staphyloly L7386-1MG 1mg 16,950,000 Sigma
455 Lincomycin hydrochloride LB0604-25G 25G 4,500,000 BioBasic
456 D-Lactose, monohydrate LC4280 500gr 4,950,000 BioBasic
457 Lysozyme .SIZE.5G LDB0308 7,950,000 BioBasic
458 Lysozyme LDB0308 1gr 2,500,000 BioBasic
459 Lysozyme LDB0308-25G None 34,000,000 BioBasic
460 Lysozyme 600mg LDB0308-600mg None 1,750,000 BioBasic
461 500bp-10kb Ladder ready to use.SIZE.100 loading M101R-1-100 loading None 6,950,000 BioBasic
462 DNA Marker Wide Range,Ready to use (100bp-10Kb) M103R-1 100 loading 8,950,000 BioBasic
463 Lamda DNA / HindIII Marker, Ready to use7 DNA fragments : 23130*, 9416, 6557, 4361*, 2322, 2027 & 564 M104R-1 100 loading 3,500,000 BioBasic
464 100+50bpDNA Marker,Ready-to-use:11 DNA fragments:150,250,350,450,550,650,750,850,1000,1500bp M109-A 100 Loading 6,950,000 BioBasic
465 F8 monoclonal antibody, clone 101 MAB4180 100 ug 39,500,000 Abnova
466 Magnesium acetate, tetrahydrate MB0326 500gr 2,950,000 BioBasic
467 Magnesium chloride, hexahydrate MB0328 500gr 3,500,000 BioBasic
468 Magnesium chloride, hexahydrate.SIZE.100G MB0328-100G 100G 1,100,000 BioBasic
469 Manganese chloride, tetrahydrate MB0331 1KG 4,800,000 BioBasic
470 DL-Malic acid MB0333 250gr 1,500,000 BioBasic
471 Manganese sulfate, monohydrate MB0334 500G 3,600,000 BioBasic
472 D-Mannitol MB0335 100gr 1,950,000 BioBasic
473 MES, free acid, monohydrate MB0341 25gr 2,950,000 BioBasic
474 MES, free acid, monohydrate MB0341-100G 100g 5,950,000 BioBasic
475 MES, free acid, monohydrate MB0341-5G 5G 1,200,000 BioBasic
476 Methylene blue, chloride, trihydrate.SIZE.50G MB0342 None 2,500,000 BioBasic
477 L-Methionine MB0346 25gr 3,950,000 BioBasic
478 Molybdic acid, sodium salt MB0358 50gr 2,950,000 BioBasic
479 D-Mannose MB0554 100G 12,000,000 BioBasic
480 Manganese acetate, tetrahydrate MB0600 250G 2,300,000 BioBasic
481 Menthol MB0608 50gr 3,200,000 BioBasic
482 Methylamine hydrochloride MB0613 100G 3,200,000 BioBasic
483 Methyl blue, sodium salt MB0614 50g 2,500,000 BioBasic
484 Methyl red  MB0627 25gr 2,500,000 BioBasic
485 Methyl red sodium salt MB0628 25G 2,950,000 BioBasic
486 Mycophenolic acid MB0640 1gr 3,950,000 BioBasic
487 MU-Gal MB1136 250mg 4,500,000 BioBasic
488 MgCl2 1.5ml MB1193-1.5ml 1.5ml 950,000 BioBasic
489 MUG MB2251-250MG 250mg 4,200,000 BioBasic
490 Malachite green oxalate MD0330 50G 1,950,000 BioBasic
491 Mucic acid MD1225 50gr 3,950,000 BioBasic
492 MOPSO, sodium salt MDB0095 25gr 2,950,000 BioBasic
493 MOPS, sodium salt MDB360S 100gr 8,500,000 BioBasic
494 MOPS, sodium salt MDB360S-25g None 3,500,000 BioBasic
495 MOPS, sodium salt MDB360S-5g None 1,500,000 BioBasic
496 Malt Extract MJ873(G257) 100gr 2,500,000 BioBasic
497 Magnesium sulfate, heptahydrate, biotech MRB0329 500gr 2,950,000 BioBasic
498 NADP N0760 250MG 6,950,000 BioBasic
499 L-Norleucine N2857 5G 5,950,000 BioBasic
500 L-Norvaline N4058 5G 1,950,000 BioBasic
501 Neomycin sulfate NB0366 25gr 4,950,000 BioBasic
502 Neomycin sulfate NB0366-5g None 1,950,000 BioBasic
503 Ninhydrin NB0378 25gr 4,200,000 BioBasic
504 Ninhydrin NB0378-1g None 950,000 BioBasic
505 Ninhydrin NB0378-5g None 1,950,000 BioBasic
506 Nystatin NB0390 5gr 3,950,000 BioBasic
507 NAD-Trihydrate NB0641 1gr 3,500,000 BioBasic
508 NADH disodium salt, trihydrate, Reduced NB0642 1gr 6,500,000 BioBasic
509 Neutral red NB0652 25gr 3,950,000 BioBasic
510 Neutral red NB0652-5g None 1,500,000 BioBasic
511 Nicotinamide NB0659 250gr 4,200,000 BioBasic
512 Nicotinic acid (NIACIN) NB0660 250gr 4,200,000 BioBasic
513 NON-Fat Powdered Milk NB0669 250g 4,500,000 BioBasic
514 1-Naphthaleneacetic acid NB0729 100gr 4,950,000 BioBasic
515 β-Naphthoxyacetic acid NB0731 100gr 2,950,000 BioBasic
516 Nalidixic acid ND0363 25g 3,950,000 BioBasic
517 Nalidixic acid .SIZE.5G ND0363-5g None 1,500,000 BioBasic
518 1-Nitro-2-naphthol-3,6 ND1226 25G 2,950,000 BioBasic
519 Nitrotetrazolium blue chloride (NBT) NDB0379 250mg 3,500,000 BioBasic
520 Nitrotetrazolium blue chloride (NBT) NDB0379 1gr 11,000,000 BioBasic
521 Nitrotetrazolium blue chloride (NBT).SIZE.800MG NDB0379-800mg None 9,500,000 BioBasic
522 Nonidet P-40 (NP-40) NDB0385 100ml 2,950,000 BioBasic
523 Orange II O14Z25 25gr 1,950,000 BioBasic
524 Protein Standard 2mg/ml, Ovalbumin O715080 2ml 1,800,000 BioBasic
525 Ofloxacin OB0673-25G 25G 3,500,000 BioBasic
526 Orange G, sodium salt OB0674 25gr 2,950,000 BioBasic
527 Oxacillin, sodium salt OB0677-25G 25G 12,000,000 BioBasic
528 Oligo dT cellulose OB1142 100mg 3,950,000 BioBasic
529 L-Ornithine, monohydrochloride OB7771 25gr 2,950,000 BioBasic
530 Oil Red O OD0395 50g 3,300,000 BioBasic
531 Oxalic acid. dihydrate OD0400-250g None 2,500,000 BioBasic
532 Pyronin B P0724 5gr 4,350,000 BioBasic
533 pH Standard solution pH11.0 P2311 100ml 3,300,000 BioBasic
534 Polygalacturonic acid 85% 25gr Sigma P3889-25g None 17,500,000 Sigma
535 Polygalacturonic acid 85% 5gr Sigma P3889-5g None 4,500,000 Sigma
536 Trypsin (Bovine), Modified, Sequencing Grade P5320 4*25ug 12,500,000 Abnova
537 Penicillin G, sodium salt PB0135 25gr 3,950,000 BioBasic
538 Penicillin G, sodium salt PB0135 100gr 9,500,000 BioBasic
539 Penicillin G, sodium salt.SIZE.5G PB0135-5g None 1,950,000 BioBasic
540 Pepsin 1: 3000 PB0411 100gr 7,950,000 BioBasic
541 Phenol red PB0420 25gr 4,500,000 BioBasic
542 Phenol red PB0420-10G 10g 2,850,000 BioBasic
543 Phenol red PB0420-5G 5g 1,500,000 BioBasic
544 L-Phenylalanine.SIZE.50G PB0422-50gr 50g 2,950,000 BioBasic
545 PEG 4000 PB0431 500gr 3,500,000 BioBasic
546 PEG4000.SIZE.100G PB0431-100g None 1,100,000 BioBasic
547 PEG 6000 PB0432 500gr 2,950,000 BioBasic
548 PVP-40 (Polyvinylpyrrolidone) PB0436 250gr 3,950,000 BioBasic
549 Ponceau S PB0437 25gr 2,950,000 BioBasic
550 Potassium acetate PB0438 500gr 3,850,000 BioBasic
551 Potassium carbonate, anhydrate PB0439 500G 3,600,000 BioBasic
552 Potassium chloride PB0440 500gr 3,200,000 BioBasic
553 Potassium chloride PB0440-100G 100G 1,100,000 BioBasic
554 Potassium iodide   PB0443 50gr 2,950,000 BioBasic
555 Potassium phosphate, monobasic, anhydrous PB0445 500gr 3,950,000 BioBasic
556 Potassium Phosphat,Monobasic -100G PB0445-100G 100G 1,200,000 BioBasic
557 Potassium sorbate PB0446 100gr 1,500,000 BioBasic
558 Potassium phosphate, dibasic, anhydrous PB0447 500gr 3,950,000 BioBasic
559 Proteinase K PB0451 50mg 4,950,000 BioBasic
560 Proteinase K .SIZE.250MG PB0451-250MG 250mg 19,500,000 BioBasic
561 Pancreatin-5.0 (5XUSP) from hog pancreas PB0680-50G None 3,950,000 BioBasic
562 Pancreatin-8.0 PB0681-100G 100g 5,950,000 BioBasic
563 D-Pantothenic acid hemicalcium salt (Vitamin B5) PB0683 100gr 3,950,000 BioBasic
564 Peroxidase,horseradish 100mg PB0691-100MG 100MG 19,500,000 BioBasic
565 Pluronic F-127 PB0750 100G 9,750,000 BioBasic
566 Potassium sulfate, anhydrous PB0782 500G 4,300,000 BioBasic
567 Protein A PB0789 10mg 5,500,000 BioBasic
568 Pyridoxal hydrochloride PB0795 5gr 3,950,000 BioBasic
569 L-Proline PB0923-100G 100gr 3,600,000 BioBasic
570 POPSO, disodium salt PB4959 25G 5,400,000 BioBasic
571 POPSO, free acid PB4979 25G 3,500,000 BioBasic
572 Potassium sulfite PB6688 500gr 4,300,000 BioBasic
573 Paraffin oil (Mineral oil), extra heavy fraction PC5532 100ml 1,800,000 BioBasic
574 Pyrogallol ( 1,2,3-Trihydroxybenzene) PC6880 100gr 8,500,000 BioBasic
575 10x Taq Buffer (MgCl2)1.5ml PCRB16-1.5ml 950,000 BioBasic
576 10x Taq Buffer (NH4)2SO4.SIZE.1.5ml PCRB55-1.5ML 950,000 BioBasic
577 10x Taq Buffer.SIZE.1.5ml PCRB60-1.5ml 1.5ml 950,000 BioBasic
578 Phenol red, sodium salt PD0424 25gr 3,200,000 BioBasic
579 PBS PD0435 1 tablet 85,000 BioBasic
580 Potassium ferricyanide PD0442 100gr 2,950,000 BioBasic
581 Propylene glycol ( 1,2-Propanediol) PD0450 500ml 1,950,000 BioBasic
582 Phosphotungstic acid hydrate PD1241 25gr 3,950,000 BioBasic
583 PIPES, sodium salt PDB0434 100G 7,800,000 BioBasic
584 Phosphatase Inhibitor Cocktail II PL019-1ml None 2,950,000 BioBasic
585 Proflavine hydrochloride PN1227 25G 5,950,000 BioBasic
586 Blotting Paper, 10x15cm, 100 SHEETS PP3322 None 9,500,000 BioBasic
587 Blotting Paper, 15x15cm, 100 SHEETS PP3323 None 9,950,000 BioBasic
588 Gel Blot Paper . 20x20 cm PP3324-1PK None 12,000,000 BioBasic
589 Potassium acetate.SIZE.500G PRB0438 3,950,000 BioBasic
590 Potassium bromide PT0762 500G 4,650,000 BioBasic
591 Potassium oxalate, monohydrate PT0774 500G 5,850,000 BioBasic
592 Potassium bicarbonate PT1195 500G 2,300,000 BioBasic
593 Rapid Plant RNA Isolation Kit PT4191 50preps 6,950,000 BioBasic
594 Quinine hemisulfate salt monohydrate QB0802 25G 4,500,000 BioBasic
595 Quinine sulfate, dihydrate QB0803 25G 3,300,000 BioBasic
596 Green-2-Go 2X qPCR-S Mastermix QPCR004-S-1.25ML None 6,950,000 BioBasic
597 Green-2-Go TaqProbe qPCR Mastermix-no Dye ) QPCR005-NODYE.1.25ML None 6,950,000 BioBasic
598 Green-2-Go 1-Step qRT-PCR Mastermix-No Dye (100X20ul Rxn) QPCR007-NODYE.100 None 28,000,000 BioBasic
599 Hs-ALPL-1-SG QuantiTect primer assay QT00012957 Pack 12,000,000 Qiagen
600 Hs-SPARC-1-SG QuantiTect primer assay QT00018620 Pack 12,000,000 Qiagen
601 Hs-RB1-1-SG QuantiTect primer assay QT00066899 Pack 12,000,000 Qiagen
602 Hs-BGLAP-1-SG QuantiTect primer assay QT00232771 Pack 12,000,000 Qiagen
603 Hs-SPP1-1-SG QuantiTect primer assay QT01008798 Pack 12,000,000 Qiagen
604 Taq DNA polymerase 50 unit R001Q None 3,950,000 TaKaRa
605 جعبه 5 خانه مخصوص تیوب سانتریفیوژ(تیوب 5/1 یا 2 میلی لیتر) R005-G Pack 400,000 BioBasic
606 جعبه 5 خانه مخصوص تیوب سانتریفیوژ (ویال شیشه ای 3 میلی لیتر) R006-G Pack 400,000 BioBasic
607 جعبه 5 خانه مخصوص تیوب سانتریفیوژ (ویال شیشه ای 10 میلی لیتر) R007-G Pack 400,000 BioBasic
608 TaKaRa Taq Hot Start 50 units R007Q None 4,950,000 TaKaRa
609 Rosaniline chloride R2770 25gr 2,500,000 BioBasic
610 کاور مخصوص رک 80 خانه دورو  بدون رنگ R567-C Pack 450,000 BioBasic
611 کاور مخصوص رک 96 خانه دورو  بدون رنگ R577-C Pack 450,000 BioBasic
612 Rhodamine B RB0464 100gr 3,950,000 BioBasic
613 RNase A RB0473 25mg 2,950,000 BioBasic
614 Rubidium chloride RB0668 25gr 16,500,000 BioBasic
615 Ribostamycin sulfate salt RB0807 5gr 3,200,000 BioBasic
616 Rifampicin RB0808 25g 8,950,000 BioBasic
617 Rifampicin RB0808-5G None 2,500,000 BioBasic
618 Rose Bengal, sodium salt RB0809 50gr 9,500,000 BioBasic
619 Rose Bengal, sodium salt RB0809-10G 10G 2,950,000 BioBasic
620 Rose Bengal, sodium salt RB0809-25gr 25gr 5,500,000 BioBasic
621 Multi-channel Reagent Boat 100 ml (Reservoir) RB333 Pack 350,000 BioBasic
622 2 x RIPA Buffer I ( pH 7.4) 2 x concentrate RB4475 500ml 3,950,000 BioBasic
623 2 x RIPA Buffer II (Ph8.0)2x concentrate RB4476 500ml 3,950,000 BioBasic
624 Recombinant Vascular Endothelial Growth Factor165 RC216-16.SIZE.2UG None 9,750,000 BioBasic
625 Riboflavin 25g RD0470-25g None 1,950,000 BioBasic
626 D-Ribose RD0475 25gr 2,500,000 BioBasic
627 Sodium sulfate, anhydrate RD0489 2.5KG 8,550,000 BioBasic
628 Sodium sulfate, anhydrate RD0489-500G 500G 2,500,000 BioBasic
629 Raffinose, pentahydrate RJ392 25gr 5,500,000 BioBasic
630 TaKaRa EX Taq Hot Start 250 units RR006A None 22,000,000 TaKaRa
631 TaKaRa EX Taq Hot Start 50 units RR006Q None 5,950,000 TaKaRa
632 TaKaRa EX Taq Hot Start 20 units RR006Q-20U None 2,950,000 TaKaRa
633 Real Time one step RNA PCR kit, Version 2 RR026 100 Test 22,000,000 TaKaRa
634 TaKaRa LA Taq HS (dNTP inclus) RR042Q None 7,500,000 TaKaRa
635 سل شیشه ای با درب حجم 1.7 میلی لیتر به ابعاد45*12.5*7.5 میلیمتر S003-G Pack 1,500,000 BioBasic
636 سل شیشه ای با درب به ابعاد 45*12.5*12.5 میلیمتر با حجم 3.5 میلی متر S004-G Pack 1,500,000 BioBasic
637 Sodium thioglycolate S0265 100G 4,950,000 BioBasic
638 Sodium phosphate, dibasic ,anhydrous S0404 500gr 3,500,000 BioBasic
639 Sudan black B S0593 5gr 1,500,000 BioBasic
640 Spermidine trihydrochloride S714272 5,500,000 BioBasic
641 Sodium sulfate, anhydrate SB0298 500G 1,800,000 BioBasic
642 Sodium chloride SB0476 1kg 1,950,000 BioBasic
643 Sodium chloride.SIZE.5KG SB0476-5KG 5kg 7,950,000 BioBasic
644 Sodium acetate, trihydrate SB0481 500g 1,950,000 BioBasic
645 Sodium bicarbonate SB0482 500g 1,800,000 BioBasic
646 Sodium acetate 3M solution SB0483 500ml 1,500,000 BioBasic
647 D-Sorbitol .SIZE.100G SB0491-100g None 850,000 BioBasic
648 Streptomycin sulfate SB0494 50gr 3,950,000 BioBasic
649 Streptomycin sulfate .SIZE.10G SB0494-10g None 1,500,000 BioBasic
650 Sucrose SB0498 500gr 1,800,000 BioBasic
651 Sucrose SB0498-2.5KG None 6,950,000 BioBasic
652 5-Sulfosalicylic acid, dihydrate SB0610 250gr 5,950,000 BioBasic
653 5-Sulfosalicylic acid, dihydrate SB0610 50gr 1,600,000 BioBasic
654 Sodium oxalate SB0829 500G 9,300,000 BioBasic
655 Sodium L-ascorbate SB0830 100gr 2,500,000 BioBasic
656 Sodium benzoate SB0833 500gr 2,500,000 BioBasic
657 Sodium bisulfite SB0834 500gr 2,950,000 BioBasic
658 Sodium bromide SB0837 250gr 2,950,000 BioBasic
659 Sodium butyrate SB0838 5gr 2,500,000 BioBasic
660 Sodium cholate, hydrate SB0841 25gr 3,950,000 BioBasic
661 Cromolyn sodium salt SB0843 5G 3,300,000 BioBasic
662 Sodium diphenylamine-4-sulfonate SB0847-10g None 9,500,000 BioBasic
663 Sodium diphenylamine-4-sulfonate SB0847-25g None 19,500,000 BioBasic
664 Sodium diphenylamine-4-sulfonate SB0847-5g None 4,950,000 BioBasic
665 Sodium metabisulfite SB0862 500gr 2,500,000 BioBasic
666 Sodium periodate SB0875 25gr 2,500,000 BioBasic
667 Sodium phosphate, monobasic, anhydrous SB0878 500gr 3,950,000 BioBasic
668 Sodium phosphate, monobasic, dihydrate SB0879 500gr 3,500,000 BioBasic
669 Sodium pyruvate SB0884 100gr 4,500,000 BioBasic
670 Sodium pyruvate SB0884 10gr 1,500,000 BioBasic
671 Sodium salicylate SB0885 250G 2,700,000 BioBasic
672 Sodium succinate, dibasic, hexahydrate SB0889 500G 6,300,000 BioBasic
673 Sodium Thiocyanate SB0897 250gr 2,950,000 BioBasic
674 Sorbic acid SB0899 500G 4,500,000 BioBasic
675 Spermine tetrahydrochloride SB0902 1gr 5,850,000 BioBasic
676 Starch soluble SB0904 500gr 3,750,000 BioBasic
677 Sudan IV (sudan Red 4) SB0914 25G 1,950,000 BioBasic
678 Sulfur sublimed SB0917 250gr 2,500,000 BioBasic
679 L-Serine SB1479 25gr 3,500,000 BioBasic
680 L-Serine SB1479-10G 10g 1,950,000 BioBasic
681 L-Serine SB1479-5G 5g 1,100,000 BioBasic
682 Sodium acetate, anhydrate SB1611 500gr 3,200,000 BioBasic
683 Saponin SB4521 25gr 2,600,000 BioBasic
684 Sodium Bismuthate SB7820 25gr 5,700,000 BioBasic
685 Sodium bisulfate, monohydrate SB7834 500G 2,950,000 BioBasic
686 Succinic anhydride SB7835-250g None 2,950,000 BioBasic
687 Sodium phosphate, tribasic, dodecahydrate SC8240-500g None 2,950,000 BioBasic
688 Sodium thiosulfate, pentahydrate SD0256 500gr 2,100,000 BioBasic
689 Sodium borate, decahydrate SD0480 500gr 1,950,000 BioBasic
690 Succinic acid SD0496 500gr 4,200,000 BioBasic
691 پلیت DNA 96 خانه با غشاء(960 میکرو مول) SD5007 plate 2,100,000 BioBasic
692 LB Agar Broth SD7003(S519) 250gr 3,950,000 BioBasic
693 LB AGAR BROTH SD7003(S519)-100g None 2,500,000 BioBasic
694 LB AGAR BROTH SD7003(S519)-50g None 1,500,000 BioBasic
695 LB-Top Agar SD7004-250g None 3,950,000 BioBasic
696 LB BROTH LENNOX.SIZE.250G SD7005(S516) None 3,950,000 BioBasic
697 LB Lennox Agar SD7006-250g None 3,950,000 BioBasic
698 SOB BROTH.SIZE.250G SD7007 None 3,950,000 BioBasic
699 Sob Agar SD7008 250gr 3,950,000 BioBasic
700 NZCYM Broth SD7010 100G 2,600,000 BioBasic
701 NZCYM Agar SD7011 100G 2,600,000 BioBasic
702 NZYM Broth SD7012 100G 2,300,000 BioBasic
703 NZYM Agar SD7013 100G 2,600,000 BioBasic
704 NZM Broth SD7014 100G 2,300,000 BioBasic
705 NZM Agar SD7015 100G 2,600,000 BioBasic
706 YT Broth SD7016-250g None 3,950,000 BioBasic
707 YT Agar SD7017-250g None 4,500,000 BioBasic
708 2x YT Agar SD7020-250g None 3,950,000 BioBasic
709 2x YT Top Agar SD7021-250g None 3,950,000 BioBasic
710 YPD Broth SD7022-250g None 3,950,000 BioBasic
711 YPD Agar SD7023-250g None 3,950,000 BioBasic
712 M9 Medium SD7024 250G 3,950,000 BioBasic
713 YM Medium SD7031 250G 3,950,000 BioBasic
714 YM Agar SD7034 250G 4,950,000 BioBasic
715 TERRIFIC BROTH.SIZE.250G SD7035(DJ980) None 3,950,000 BioBasic
716 EDTA 0.5M sterile solution SD8135 450ml 3,950,000 BioBasic
717 Sodium lauroyl sarcosine SDB0486-50g None 1,950,000 BioBasic
718 Sodium phosphate, dibasic, heptahydrate.SIZE.100G SDB0487-100G 100G 1,100,000 BioBasic
719 Sodium carbonate,anhydrous 2.5kg SDB0615 8,950,000 BioBasic
720 Sodium carbonate, anhydrous SDB0615 500g 2,500,000 BioBasic
721 Sodium carbonate, anhydrous.SIZE.100G SDB0615-100g None 950,000 BioBasic
722 Sudan Red 7 B SJ227 10gr 3,300,000 BioBasic
723 Sulfobetaine 8 SJ547 1gr 2,950,000 BioBasic
724 Sulfobetaine 10 SJ548 1gr 3,200,000 BioBasic
725 Sulfobetaine 12 SJ550 1gr 3,200,000 BioBasic
726 Lowry Protein Assay Kit SK4031-1000 Assays None 4,500,000 BioBasic
727 EZ-10 Spin Column Blood Genomic DNA MiniPreps Kit SK8253 50preps 7,500,000 BioBasic
728 EZ-10 Spin Column Blood Genomic DNA MiniPreps Kit SK8254 100 PRE 14,500,000 BioBasic
729 EZ-10 Spin Column Plant Genomic DNA Mini-Preps Kit SK8262 100 PREPS 13,950,000 BioBasic
730 SanPrep Column microRNA Mini-Preps Kit SK8811 50PRES 11,000,000 BioBasic
731 قاشقک استیل 180 میلیمتر SP064 Pack 1,350,000 BioBasic
732 اسکوپ استیل 160 میلیمتر SP072 Pack 900,000 BioBasic
733 میکرو اسپاتول تخت  با انتهای گرد 160 میلیمتر SP075 Pack 1,100,000 BioBasic
734 پیمانه استیل بزرگ SP076 Pack 1,800,000 BioBasic
735 پیمانه استیل متوسط SP077 Pack 1,800,000 BioBasic
736 سل کوارتز UV استاندارد با درب تفلونی دو طرف مات با ابعاد 45*12.5*12.5 و حجم 3.5 میلی لیتر SQ014 Pack 13,500,000 BioBasic
737 سل کوارتز با درب ساده 4 طرف مات به ابعاد 45*12.5*12.5 میلیمتر با حجم 0.7 میلی لیتر UV میکرو SQ244 عدد 7,500,000 BioBasic
738 سل کوارتز با درب تفلونی 4 طرف مات به ابعاد 45*12.5*12.5 میلیمتر و حجم 1.4 میلی لیتر UV سمی میکرو SQ294 عدد 11,000,000 BioBasic
739 Sodium acetate SRB1611 500gr 3,500,000 BioBasic
740 GDF9 human 20ug Sigma SRP4872 None 55,000,000 Sigma
741 EZ-10 Spin Column Soil DNA Mini-Preps Kit ST82316 50 preps 7,500,000 BioBasic
742 Thiazoyl blue tetrazolium bromide (MTT) T0793-500mg 500mg 4,950,000 BioBasic
743 Retro Nectin Dish 1 plate T110A None 4,950,000 TaKaRa
744 Tris-(hydroxymethyl) propane T1491-100g None 4,950,000 BioBasic
745 TNBT (Titanium(IV) butoxide) T6756 250MG 6,950,000 BioBasic
746 Western BLoT Immuno Booster Sample T7111Q 20ml 1,950,000 TaKaRa
747 Western BLoT Rapid Detect Sample T7121Q 2test 2,950,000 TaKaRa
748 Trimethoprim T714206 5g 3,500,000 BioBasic
749 One-Tube Swab DNA Extraction Kit T71612 20preps 3,950,000 BioBasic
750 PBS T900 1Tablets 95,000 TaKaRa
751 Tris-Glycine-SDS powder T901 Pack 550,000 TaKaRa
752 Tris Glycin powder T902 Pack 450,000 TaKaRa
753 L-broth powder T904 Pack 550,000 TaKaRa
754 Tris hydrochloride TB0103 250gr 4,500,000 BioBasic
755 TES, sodium salt TB0124 25G 3,600,000 BioBasic
756 Tris  TB0194 2.5kg 25,500,000 BioBasic
757 Tris  TB0194 500gr 5,500,000 BioBasic
758 Tris TB0194-100g None 1,950,000 BioBasic
759 Triton X-100 TB0198 500ml 2,500,000 BioBasic
760 TMB dihydrochloride TB0514 1gr 4,500,000 BioBasic
761 TMB dihydrochloride.SIZE.5G TB0514 None 17,500,000 BioBasic
762 Polyoxyethylene-20 (TWEEN 20) TB0560 500ml 2,950,000 BioBasic
763 2,3,5-Triiodobenzoic acid TB0735 5gr 2,950,000 BioBasic
764 L-Threonine TB0919 100gr 4,500,000 BioBasic
765 TAPS, sodium salt TB0920 50G 4,500,000 BioBasic
766 L-Tartaric acid TB0925 500G 7,950,000 BioBasic
767 Taurine TB0926 100gr 3,950,000 BioBasic
768 TES, free acid TB0927 50G 5,400,000 BioBasic
769 Thymine TB0943-100g None 7,500,000 BioBasic
770 Thymol blue, free acid TB0944 25G 5,950,000 BioBasic
771 Thymolphthalein TB0945 25G 4,800,000 BioBasic
772 Thymol TB0946 25gr 3,300,000 BioBasic
773 Tiron TB0951 25G 4,950,000 BioBasic
774 Toluidine Blue O TB0962 5G 2,950,000 BioBasic
775 L-Tryptophan TB1911-1g None 850,000 BioBasic
776 L-Tryptophan TB1911-5g None 1,750,000 BioBasic
777 L-Tryptophan TB1911-800mg None 750,000 BioBasic
778 L-Tyrosine TB1932-10G 10g 1,500,000 BioBasic
779 TAPS, free acid TB3566 50G 2,950,000 BioBasic
780 تیوب 5/1 میلی لیتر ته مخروطی با درب پیچی آبی ،استریل ، Rnase/DNase Free بسته پانصد عددی TC153-SB  500pcs 4,950,000 BioBasic
781 تیوب 65/1 میلی لیتر ته مخروطی با درب پیچی قرمز ،استریل Rnase/DNase Free، بسته پانصد عددی TC154-SR 500pcs 4,950,000 BioBasic
782 1.5ML CONICAL TUBE WITH SCREWCAP, AMBER,500/BAG TC157-A 500/BAG 4,950,000 BioBasic
783 1.5ML CONICAL TUBE WITH SCREW CAP, STERILE, GREEN,500/BAG TC157-SG 4,950,000 BioBasic
784 Tris acetate TD0101-25gr 25gr 1,600,000 BioBasic
785 Culture Tube, 12 ml, Natural, Dual Cap, Sterile TD444-S.SIZE.1PK None 1,800,000 BioBasic
786 Triton X-114.SIZE.500ML TDB0554 500ml 3,200,000 BioBasic
787 TTC (TTZ) TDB0558 5gr 2,950,000 BioBasic
788 1.5ML SKIRTED TUBE WITH SCREWCAP, STERILE, NATURAL,500/BAG TK352-SN None 4,950,000 BioBasic
789 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, BLUE,500/BAG TK353-SB None 4,950,000 BioBasic
790 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, RED,500/BAG TK354-SR None 4,950,000 BioBasic
791 1.5ML Skirted Tube With Screw Cap, Amber, 500/Bag TK357-A بسته 6,950,000 BioBasic
792 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, GREEN,500/BAG TK357-SG None 4,950,000 BioBasic
793 Thymol blue, sodium salt TN1195 25G 6,950,000 BioBasic
794 Triton X-405 TS4449 100ML 4,500,000 BioBasic
795 غلطک پلیت با دسته چوبی TSM113 Pack 1,400,000 BioBasic
796 Trypan Blue TT1140 10g 3,500,000 BioBasic
797 Uracil UD0564 100gr 3,500,000 BioBasic
798 Uridine UD0570 25gr 8,500,000 BioBasic
799 L-Valine VB0172 500G 21,000,000 BioBasic
800 L-Valine 100G VB0172-100G 100G 4,950,000 BioBasic
801 L-Valine 250G VB0172-250G 250G 13,500,000 BioBasic
802 Vancomycin hydrochloride VB0983 1g 7,500,000 BioBasic
803 Victoria blue B VB0985 25gr 2,950,000 BioBasic
804 Rapid Viral RNA Extraction Kit VT4184 50preps 16,500,000 BioBasic
805 Wright's stain (Eosin methyl blue) WB0989 25gr 5,500,000 BioBasic
806 Xylene cyanol FF XB0005-5G None 2,500,000 BioBasic
807 Xylenol orange XB0996 10G 6,950,000 BioBasic
808 Xylitol XB0997 100gr 2,500,000 BioBasic
809 بطری پلاستیکی برای شستشو/درب آبی-قابل اتوکلاو(پی ست) XP001 Pack 550,000 BioBasic
810 Zymosan A ZB4250 100 mg 5,950,000 BioBasic

محصولات ناموجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 Sodium Chloride 5KG ناموجود Acros
2 Sodium Hydroxide 1KG ناموجود Merck
3 کلريد سديم-امينسان ناموجود ایرانی
4 پليت 6 خانه کشت سلول استريل plate ناموجود None
5 TSH 96 Test Elisa Aminsan None ناموجود None
6 Iso Propanol 2.5lit ناموجود Applichem
7 پي پت پاستور شيشه اي بلند 250عددي None ناموجود None
8 بنزن-امينسان None ناموجود ایرانی
9 ترازو دوکفه اي 200گرم None ناموجود None
10 استريپ 0.2 (8تايي) None ناموجود چینی
11 رک کرايوتيوب 1.8 Pack ناموجود چینی
12 آب اکسیژنه 2.5lit ناموجود Merck
13 سنتز پرايمر Page 100nmol None ناموجود BioBasic
14 tris ايراني None ناموجود ایرانی
15 بشر1000 سي سي None ناموجود None
16 گلايسين 50gr ايراني ناموجود ایرانی
17 سمپلر متغيير 500 الي 5000 Unit ناموجود None
18 سرسمپلر آبي Dnase Rnase Free None ناموجود None
19 بشر 600 سي سي None ناموجود None
20 پليت 48 خانه استريل plate ناموجود None
21 Buffer Z None ناموجود TaKaRa
22 لوله فالکون 15 بسته 25عددي استريل Biofil 25 pcs ناموجود Jetbiofil
23 فلاسک T25 بسته 10 عددي فيلتر دار Biofil کانادا 10 pcs ناموجود Jetbiofil
24 Bis Acrylamid 25g ناموجود Acros
25 پنبه غیر استریل بسته ناموجود ایرانی
26 Buffer Taq*10 None ناموجود TaKaRa
27 DMSO 2.5 lit Applichem None ناموجود Applichem
28 Buffer MgSo4 None ناموجود TaKaRa
29 فلاسک کشت سلول 12.5cm سادهbiofil کانادا 10 pcs ناموجود Jetbiofil
30 فلاسک T75 بسته 5عددي فيلتر دار Biofil کانادا 5 pcs ناموجود Jetbiofil
31 Acrylamide 100g ناموجود Acros
32 Prime STAR (high fidelity PCR) 50 u None ناموجود TaKaRa
33 Loading biffer-ايراني None ناموجود ایرانی
34 Chloroform 1lit ناموجود Merck
35 ايميدازول 100gr Acros None ناموجود Acros
36 Agarose-100gr-Acros - None ناموجود Acros
37 لوپ - pack ناموجود ایرانی
38 DNase I Solution (1 mg/mL) 0-7900 1ml ناموجود StemCell
39 Buffer H 1000 Vial ناموجود TaKaRa
40 Buffer K 1000 1ml ناموجود TaKaRa
41 Buffer L 1000 1ml ناموجود TaKaRa
42 Buffer M 1000 1ml ناموجود TaKaRa
43 Buffer Triton X100 1000 1ml ناموجود TaKaRa
44 Buffer PCR 1000 1ml ناموجود TaKaRa
45 Acetonitrile 100030 2/5L ناموجود Merck
46 Rolipram 10MG 10011132-10mg None ناموجود Cayman
47 Acc I 1001A 100U ناموجود TaKaRa
48 Zirconium chloride 10026-11-6 25 GR ناموجود Acros
49 Acc II 1002A 100 unit ناموجود None
50 Hcl Merck 2.5 lit 100317 None ناموجود Merck
51 Ethanol 100971 2.5lit ناموجود Merck
52 Ethanol 2.5lit Merck 100983 ناموجود Merck
53 BamH I 1010A 10000 U ناموجود TaKaRa
54 Ammonium persulfate [APS] 101200 1KG ناموجود Merck
55 Ban II 1012A 2000u ناموجود TaKaRa
56 Bcn I (Cau II ‘NCi1) 1019A 1,000 U ناموجود TaKaRa
57 Bgl II 1021A 2000 ناموجود TaKaRa
58 Bln I (Avr II) 1022A 400 Units ناموجود TaKaRa
59 Bsp1286 I (Sdu I) 1024A 500 Units ناموجود TaKaRa
60 4th WHO International Standard for HBV DNA for NAT 10/266 None ناموجود DUMMY
61 FBS 10270-106 500ml ناموجود Gibco
62 Dimethyl Yellow 103055-10g None ناموجود DUMMY
63 Restriction Enzyme Cpo l 1035A ناموجود TaKaRa
64 EcoT14I (StyI) 1038A 3,000 Units ناموجود TaKaRa
65 EcoR I 1040A 10000 U ناموجود TaKaRa
66 EcoR V 1042A 3000u ناموجود TaKaRa
67 Restriction Enzyme EcoO109 l 1043A ناموجود TaKaRa
68 Fba I (Bcl I) 1045A 500units ناموجود TaKaRa
69 Fok I 1046A 1,000 Units ناموجود TaKaRa
70 L-Arabinose 25gr 10498 Acros ناموجود BioBasic
71 Hae III 1051A 4000Units ناموجود TaKaRa
72 1,1,1,3,3,3-Hexafluoro-2-propanol 105228-5G None ناموجود DUMMY
73 Hae II 1052A 1000unit ناموجود TaKaRa
74 Hap II (Hpa II, Msp I) 1053A 2,000 Units ناموجود TaKaRa
75 آمونیاک 105426 2.5lit ناموجود Merck
76 Hha I 1056A 2,000 Units ناموجود TaKaRa
77 HincII (HindII) 1059A 1,000 Units ناموجود TaKaRa
78 Methanol Merck 2.5 lit 106007 None ناموجود Merck
79 Methanol 106008 2.5lit ناموجود Merck
80 Methanol 106018 2.5lit ناموجود Merck
81 دی کلرو متان 106050 2.5lit ناموجود Merck
82 Hind III 1060A 10000 U ناموجود TaKaRa
83 HpaI 1064A 500 Units ناموجود TaKaRa
84 Kpn I 1068A 5000u ناموجود TaKaRa
85 Mfl I (Xho II) 1070A 500 Units ناموجود TaKaRa
86 PstI 1073A 10,000 Units ناموجود TaKaRa
87 Sac I 1078A 2000 U ناموجود TaKaRa
88 Sac II 1000u 1079A 1000u ناموجود TaKaRa
89 Sal I 1080A 3,000 Units ناموجود TaKaRa
90 Sau3AI (MboI) 1082A 200 Units ناموجود TaKaRa
91 Histopaque(ficoll) 10831 100ml ناموجود Sigma
92 Sma I 1085A 2000u ناموجود TaKaRa
93 گزیلول 108681 2.5lit ناموجود Merck
94 Spe I 1086A 300 units ناموجود TaKaRa
95 Xba I 1093A 3,000 Units ناموجود TaKaRa
96 Xho I 1094A 5000U ناموجود TaKaRa
97 Xsp I (Bfa I, Mae I) 1095A 500 Units ناموجود TaKaRa
98 2پروپانول Merck 2.5 lit 109634 None ناموجود Sigma
99 Afa I (Rsa I ) 1000 units 1116A 1000U ناموجود TaKaRa
100 Eae I (Cfr I) 1123A 200 Units ناموجود TaKaRa
101 EcoO65I (BstEII, BstPI) 1135A 1,000 Units ناموجود TaKaRa
102 Sodium Pyrivate MEM 11360039 None ناموجود Invitrogen
103 Mbo II 1145A 400Units ناموجود TaKaRa
104 Msp I (Hpa II) 1150A 3,000 Units ناموجود TaKaRa
105 Water HPLC grade 115333 2.5lit ناموجود Merck
106 Skim milk powder 115363 500g ناموجود Merck
107 Nae I 1155A 500Unit ناموجود TaKaRa
108 Nco l 1160A 500Unit ناموجود TaKaRa
109 Nde I 1161A 400u ناموجود TaKaRa
110 LIFE TECHNOLOGIES LIPOFECTAMINE REAGENT 0.3ML 11668-030 None ناموجود None
111 DNA Molecular Weight Marker VII. DIG-labeled 11669940910 None ناموجود DUMMY
112 Not I 1166A 500 U ناموجود TaKaRa
113 2.4 dinitrophenyl hydrazin* 11706 None ناموجود DUMMY
114 Taq I 1189A 2000u ناموجود TaKaRa
115 VpaK11B I (Ava II) 1196A 300 Units ناموجود TaKaRa
116 Dpn I (Mal I) 1235A 1,000 Units ناموجود TaKaRa
117 Hinf I 1238A 6000U ناموجود TaKaRa
118 Nhe I 1241A 700U ناموجود TaKaRa
119 Pvu II 1243A 4,000 Units ناموجود TaKaRa
120 SphI 1246A 600u ناموجود TaKaRa
121 pOptiVEC™-TOPO® TA Cloning® Kit 12744-017 kit ناموجود Invitrogen
122 Vindoline 13940871-10MG 10mg ناموجود Molekula
123 Vindoline 13940871-1MG None ناموجود Molekula
124 Hepatitis C virus (HCV) For nucleic acid amplification techniques (5th International standard 2015) 14/150 None ناموجود DUMMY
125 Non WHO Reference Material 4th HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques 14/290 None ناموجود DUMMY
126 Pen/Strep 20 ml Invitrogen 15140148 None ناموجود Invitrogen
127 Calsemid Invitrogen 10ml 15210-057 None ناموجود Invitrogen
128 15547 100 mg 15547 None ناموجود DUMMY
129 ReadyStrip™ IPG Strips* 1632007 None ناموجود Biorad
130 ReadyStrip™ IPG Strips 1632008 None ناموجود None
131 100x BioLyte® 3/10 Ampholyte 1632094 1pack ناموجود Biorad
132 Guanidine hydrochloride, biotech* 17577-25g None ناموجود DUMMY
133 آلژنیک اسید 180947 100gr ناموجود Sigma
134 UREA pearls 98% 1KG 197460010 Acros ناموجود BioBasic
135 Urea-500g- Acros 19746-500g None ناموجود DUMMY
136 in vivo jetPEI Transfection Reagent (glucose inclus) 201-10G None ناموجود DUMMY
137 T4 DNA Ligase 2011A 25000u ناموجود TaKaRa
138 Pro measure protein measurement solution 21011 None ناموجود DUMMY
139 DNA Polymerase I(E.coli) 2130A 500 Units ناموجود TaKaRa
140 Klenow Fragment 2140A 200unit ناموجود TaKaRa
141 Imidazole 21611083 500g ناموجود Molekula
142 Poly(A) Polymerase 2180A 20 Units ناموجود TaKaRa
143 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
144 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
145 Recombinant DNase I ,(RNase free) 2270A 1000u ناموجود TaKaRa
146 pvp 227545 100gr ناموجود Acros
147 Apigenin 22930039-1G ناموجود Molekula
148 SDS Acros 100g 23042 100g ناموجود Acros
149 Recombinant RNase Inhibitor 2313A 5000u ناموجود TaKaRa
150 Recombinant RNase Inhibitor 2313Q 500U ناموجود TaKaRa
151 1-Chloro-2,4-dinitrobenzene 237329 10g ناموجود Sigma
152 نوک کریستالی Rnase&Dnase& pyrogen free-1000pcs- Orange 2502050 None ناموجود DUMMY
153 نوک زرد فیلتردارRnase & Dnase free-Orange 2502100 None ناموجود DUMMY
154 T7 RNA Polymerase 5000U 2540A 5000 U ناموجود TaKaRa
155 Grassofermata 1MG 26202-1mg None ناموجود Cayman
156 Exonuclease I 2650A 750 Units ناموجود TaKaRa
157 PrimeScript™ Reverse Transcriptase 2680A 10000u ناموجود TaKaRa
158 PrimeScript™ Reverse Transcriptase 2680Q 2000u ناموجود TaKaRa
159 Trichloroacetic acid 27071914-1KG 1kg ناموجود Molekula
160 Methacrylic anhydride 276685-500ML None ناموجود DUMMY
161 DMEM/F-12, GlutaMAX™ supplement 31331-028 500ml ناموجود Invitrogen
162 Dextran from Leuconostoc spp.* 31390-25G None ناموجود DUMMY
163 DMEM, powder, low glucose, pyruvate 31600-034 1lit ناموجود Invitrogen
164 DMEM powder 10 lit Low glucose 31600-083 10lit ناموجود Invitrogen
165 Thiometon in Shellsol 31681-250MG None ناموجود DUMMY
166 Temozolomide 31724662-1G 1g ناموجود Molekula
167 RPMI 1640 Powder 1lit Invitrogen 31800-014 1lit ناموجود Invitrogen
168 Bifenazate 32504-50MG None ناموجود DUMMY
169 Flonicamid 32509-25MG None ناموجود DUMMY
170 pRl201-AN DNA 3264 ناموجود TaKaRa
171 T-Vector pMD20 3270 1 ug ناموجود TaKaRa
172 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-100G 100g ناموجود Molekula
173 Maltose, monohydrate 329915000-500g None ناموجود DUMMY
174 (+)-Usnic acid 329967-5G None ناموجود DUMMY
175 Acetic Acid 33209 2.5lit ناموجود Sigma
176 Chaperone Plasmid Set 3340 1 Set ناموجود TaKaRa
177 pCold DNA Cold Shock Expression System 3360 1 Set ناموجود TaKaRa
178 Ytterbium(III) chloride hexahydrate 337927-10G None ناموجود DUMMY
179 200 bp DNA ladder 3410A 50 µg ناموجود TaKaRa
180 500 bp DNA ladder 3411A 50 µg ناموجود TaKaRa
181 Wide-range DNA ladder 0.8ml TaKaRa 3415A ناموجود TaKaRa
182 Parathion-methyl 36187-100MG None ناموجود DUMMY
183 Sodium tetraborate decahydrate 367207 1Kg ناموجود Carlo
184 CellAmp™ Direct RNA Prep Kit for RT-PCR (Real Time) 3732 200 Rxns ناموجود TaKaRa
185 CellAmp™ RT-PCR for Direct Prep Kit (Real Time) & Protein Analysis 3733Q 25 preps ناموجود TaKaRa
186 Laccase  from  Trametes  versicolor 38429-1G None ناموجود DUMMY
187 Propidium Iodide (PI) 40016 None ناموجود Biotium
188 dATP 4026 100 umol ناموجود TaKaRa
189 dGTP 4027 100 umol ناموجود TaKaRa
190 dCTP 4028 100 umol ناموجود TaKaRa
191 dTTP 4029 100 umol ناموجود TaKaRa
192 dNTP mixture 4030 1.28 ml ناموجود TaKaRa
193 dNTP Mixture 180 ul 4030 180ul ناموجود TaKaRa
194 Gel Red 41003 0.5ml ناموجود Biotium
195 2-Hydroxy-4?-(2-hydroxyethoxy)-2-methylpropiophenone 410896-10G None ناموجود DUMMY
196 Paraformaldehyde 416782500 100gr ناموجود Acros
197 (+)-cat_numberechin 43412 10MG ناموجود Sigma
198 Thulium(III) chloride 439649-1G None ناموجود DUMMY
199 Dinocap 45452-100MG None ناموجود DUMMY
200 Carbazole 46100-250MG-R None ناموجود DUMMY
201 Aspartame 47135 500mg ناموجود Sigma
202 ProClin™ 300 48914-U None ناموجود DUMMY
203 Curcumin 49256996-25G 25g ناموجود Molekula
204 Curcumin 49256996-5g 5g ناموجود Molekula
205 لوله فالکون 15 استريل RNase & DNase Free بسته 50عددي 50015 None ناموجود SPL
206 RPMI 1640 Powder 1 lit Invitrogen 51800-019 1lit ناموجود Invitrogen
207 RPMI 1640 Powder 10lit Invitrogen 51800-035 10lit ناموجود Invitrogen
208 Resveratrol 51852282-1G 1g ناموجود Molekula
209 Tannic acid 52612564-1KG 1Kg ناموجود Molekula
210 DNA Ligation Kit, Mighty Mix 6023 100 Rxns ناموجود TaKaRa
211 DNA Ligation Kit Mighty Mix (20 react) 6023Q ناموجود TaKaRa
212 cDNA synthesis kit: PrimeScript First Strand cDNA Synthesis Kit 6110A 50 Rxns ناموجود TaKaRa
213 3'-Full RACE Core Set 6121 20 react ناموجود TaKaRa
214 3'-Full RACE Core Set 6122 10 react ناموجود TaKaRa
215 PrimeScript II 1st strand cDNA synthesis kit 6210A Kit ناموجود TaKaRa
216 Lenti-X™ qRT-PCR Titration Kit 200 Rnx Clontech 631235 1kit ناموجود TaKaRa
217 Xfect Transfection Reagent 631316 None ناموجود TaKaRa
218 N-Ethylmaleimide 63480 None ناموجود DUMMY
219 Real Time qPCR Master Mix - Terra qPCR Direct SYBR Premix 638319 ناموجود TaKaRa
220 1-Ethyl-3-methylimidazolium L-(+)-lactate 669512 5G ناموجود Sigma
221 فلاسک کشت سلول 25cm فيلتردار استريل بسته5 عددي 70025 None ناموجود SPL
222 فلاسک کشت سلول 75cm فيلتردار استريل بسته5 عددي 70075 None ناموجود SPL
223 Skim Milk Powder 70166-500G 500G ناموجود Sigma
224 HRV 3C Protease 500U 7360 None ناموجود TaKaRa
225 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-10G ناموجود Molekula
226 Acrylamide 800830 1kg ناموجود Merck
227 4-CHLOROPHENOL 802254 100gr ناموجود Merck
228 2.7-Dichlorodihydrofluorescein diacetate 85155-50MG None ناموجود Cayman
229 cat_numberharanthine 89985253-10MG 10mg ناموجود Molekula
230 Catharanthine 89985253-1MG None ناموجود Molekula
231 Hydroxyapatite 900193-50G None ناموجود DUMMY
232 RNase-Free Water 9012 1ml ناموجود TaKaRa
233 RNase -Free Water-1ML 9012-1ML 1ML ناموجود TaKaRa
234 IPTG 9030 5gr ناموجود TaKaRa
235 X-Gal 9031 1gr ناموجود TaKaRa
236 DNA OFF 9036 500ml ناموجود TaKaRa
237 RNase - OFF 500 ml 9037 500ml ناموجود TaKaRa
238 E. coli HB101 Competent Cells 9051 Set ناموجود TaKaRa
239 پی پت 5 استریل-SPL 91005 None ناموجود DUMMY
240 GC Buffer I 9154 1.25ml ناموجود TaKaRa
241 Loading buffer 10 X 9157 vials ناموجود TaKaRa
242 Alcian blue 8GX A0298 5gr ناموجود BioBasic
243 Potassium hydroxide A0566 1kg ناموجود Applichem
244 Albumin EIA and RIA grad A0850 500g ناموجود Applichem
245 Albumin A0850,0500 None ناموجود Applichem
246 8-Anilino-1-naphthalenesulfonic  acid A1028-5G None ناموجود Sigma
247 Amyloid beta Protein Fragment 1-40 A1075-.1MG None ناموجود Sigma
248 Calcium Chloride dried, powdered pure A1428-0500 ناموجود Applichem
249 Streptavidin ultrapure A1495 1gr ناموجود Applichem
250 Streptavidin ultrapure A1495 1mg ناموجود None
251 Acetyl coenzyme A sodium salt A2056 1MG ناموجود Sigma
252 5-Azacytidine A2385 100MG ناموجود None
253 Amphotericin B solution A2942 100ml ناموجود Sigma
254 Peroxidase HRP A3615 None ناموجود Applichem
255 Acridine orange hemi salt A742007 10G ناموجود BioBasic
256 Acridine orange hemi salt A742007-5G None ناموجود BioBasic
257 Anti-Human IgG−Peroxidase antibody produced in rabbit A8792 2ml ناموجود Sigma
258 Amberlite™ IRN-77, ion exchange resin, Nuclear grade, Alfa Aesar™ AA1682136 - Alfa Aesar™ None ناموجود DUMMY
259 Acetylcholine chloride AB0002 25gr ناموجود BioBasic
260 Agarose M AB0013 250gr ناموجود BioBasic
261 Agarose B, low EEO AB0014 250gr ناموجود BioBasic
262 Agarose, Low melting gel AB0015 10gr ناموجود BioBasic
263 Agarose, Low melting gel.SIZE.25G AB0015-25G 25G ناموجود BioBasic
264 L-Asparagine monohydrate AB0017 100g ناموجود BioBasic
265 L-Ascorbic acid ( Vitamin C) AB0021 100G ناموجود BioBasic
266 Ampicillin, sodium salt USP AB0028 25gr ناموجود BioBasic
267 Ampicillin,sodium salt USP 5gr Ab0028-5g None ناموجود BioBasic
268 Nitrilotriacetic acid AB0055 100gr ناموجود BioBasic
269 Ampicillin, trihydrate AB0064 25G ناموجود BioBasic
270 Ammonium persulfate [APS] AB0072 25G ناموجود BioBasic
271 L-Arginine free base AB0205-10G 10g ناموجود BioBasic
272 L-Arginine free base AB0205-25G 25g ناموجود BioBasic
273 L-Arginine AB0205.SIZE.500G None ناموجود BioBasic
274 Normal Goat Serum Ab156046 None ناموجود َAbcam
275  N-Acetyl-L-Cysteine AB6697 25gr ناموجود BioBasic
276 Goat  Anti-Rabbit  IgG  H&L  (HRP) AB97069 ناموجود Sigma
277 ACES AD0004 500gr ناموجود BioBasic
278 ACES AD0004-500G 500G ناموجود BioBasic
279 Adenosine AD0016 25G ناموجود BioBasic
280 Adenosine AD0016 5gr ناموجود BioBasic
281 Albumin, heat shock isolation pH 7.0 AD0023 25gr ناموجود BioBasic
282 Amido black 10B AD0027 5gr ناموجود BioBasic
283 Amphotericin B AD0030P 5g ناموجود BioBasic
284 Avidin AD0068 5MG ناموجود BioBasic
285 Mupid One Submarine AD160 دستگاه ناموجود TaKaRa
286 Ammonium sulfate ADB0060 500gr ناموجود BioBasic
287 ترازو دقیق دیجیتالی (دقت یک صدم، ظرفیت 4000 گرم AGZ4000C دستگاه ناموجود None
288 TACCAAGAGAACTACATATCCGATGACCTTCCGTGGGGCCTAGTAGTTGCGGGACTACTAGACACTGTATGA apte zia-72bp None ناموجود BioBasic
289 Albumin, Protease Free AR2449 50gr ناموجود BioBasic
290 Rapid animal G-DNA AT4780 10prep ناموجود BioBasic
291 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 320 گرم) ATA320 دستگاه ناموجود None
292 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 520 گرم) ATA520 دستگاه ناموجود None
293 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 320 گرم) ATZ320 دستگاه ناموجود None
294 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 520 گرم) ATZ520 دستگاه ناموجود None
295 Alkaline phosphatase Power AP AZ140A 1mg ناموجود BioBasic
296 Taq DNA Polymerase, 5U/UL B0089 200u ناموجود BioBasic
297 Taq DNA Polymerase, 5U/UL B0089(D0089) 1000u ناموجود BioBasic
298 TAQ DNA POLYMERASE, 5U/UL.SIZE.500U B0089(D0089)-500U None ناموجود BioBasic
299 bisBenzimide H 33258 B2883-25MG None ناموجود DUMMY
300 Boric acid BB0044 500gr ناموجود BioBasic
301 D-Biotin .SIZE.5G BB0078-5gr 5G ناموجود BioBasic
302 X-Gal BB0083 1gr ناموجود BioBasic
303 X-GLUC (X-GlcA) BB0085 25MG ناموجود BioBasic
304 Bacitracin zinc BB0113 25G ناموجود BioBasic
305 Bile salt BB0225-25G 25g ناموجود BioBasic
306 RNase H, 10U/UL BEN0202 500u ناموجود BioBasic
307 RNase I, 10U/UL BEN0601 1 Ku ناموجود BioBasic
308 10-175kDa Wide Range Protein Molecular Weight Marker, Prestained11 band: 10, 15, 20, 30, 40, 50, 60, 70, 95, 120, 175kDa BG00363 500ul ناموجود BioBasic
309 10-240kDa Wide Range 3 Color Prestained Protein Ladder BG00364 500UL ناموجود BioBasic
310 Low Range Protein Molecular Weight Marker BM201 30ul ناموجود BioBasic
311 Protein Marker, Mid Range, ready to use BM523 200ul (20 loadings) ناموجود BioBasic
312 14.4-98kDa Mid Range Protein Molecular Weight Marker BM524 200ul ناموجود BioBasic
313 0.2ML PCR TUBE, FLAT CAP BP541-S100 0.2ML ناموجود BioBasic
314 تیوب 5/0 میلی لیتر مخصوص PCRبدون رنگ با درب تخت دارای بسته بندی 1000تایی Rnase/DNase Free BP602-S100 بسته ناموجود BioBasic
315 تیوب 5/0 میلی لیتر مخصوص PCRبدون رنگ با درب تخت دارای بسته بندی 100تایی Rnase/DNase Free BP602-S100-1pak 100pcs ناموجود BioBasic
316 EZ-10 Cleanup Minipreps Kit BS367 50 PREPS ناموجود BioBasic
317 EZ-RNA Reagents (Trizol) BS409A 25ML ناموجود BioBasic
318 EZ-RNA Reagents 10ml BS409A-10ML None ناموجود DUMMY
319 EZ-RNA Reagents (Trizol) BS410A 100ml ناموجود BioBasic
320 EZ-10Spin Column Bacterial DNA Mini Preps Kit 50pr BS423-50 preps 50 preps ناموجود BioBasic
321 Fast DNA Ligation Kit(5u/ul.T4) BS512-50 Rxn None ناموجود BioBasic
322 EZ-10 Spin Column Total RNA Mini-Preps Super Kit BS584 100preps ناموجود BioBasic
323 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS614 250 preps ناموجود BioBasic
324 EZ-10 Spin Column DNA Gel Extraction Kit BS654 250 preps ناموجود BioBasic
325 One-Tube Tissue DNA Extraction Kit BS8401 100 preps ناموجود BioBasic
326 One-Tube Clinical Sample DNA Extraction Kit.SIZE.100 Preps BS8403-100prep None ناموجود BioBasic
327 One-Tube Bacteria DNA Isolation Kit BS8413 100 PREPS ناموجود BioBasic
328 RNase-Free DNase Set BS88253-50 preps None ناموجود BioBasic
329 EZ-10 Spin Column Fungal RNA Mini-Preps Kit BS91915 50 PREPS ناموجود BioBasic
330 14.4-116kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0431 2x1ml ناموجود BioBasic
331 14.4-116kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0431 1ml ناموجود BioBasic
332 20-120kDa Mid Range Protein Molecular Weight Marker, Prestained BSM0441 250UL ناموجود BioBasic
333 20-120kDa Mid Range Protein Molecular Weight Marker, Prestained BSM0441-250UL ناموجود BioBasic
334 10-200kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0661 2x250ul ناموجود BioBasic
335 10-200kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0661-250ul 250ul ناموجود BioBasic
336 10-170kDa Wide Range Protein Molecular Weight Marker, Prestained BSM0671 2x250ul ناموجود BioBasic
337 10-170kDa Wide Range Protein Molecular Weight Marker, Prestained BSM0671-250ul 250ul ناموجود BioBasic
338 Total Protein Extraction Kit BSP003 50preps ناموجود BioBasic
339 0.1-10ul Micro Tips, Short,1000/Pack,Sterile BT215 1000Pack ناموجود BioBasic
340 سرسمپلرکریستالی کوتاه (10-0.1 میکرو لیتر) استریل Rnase/DNase Free بسته هزار عددی BT215-S بسته هزار عددی ناموجود BioBasic
341 سر سمپلر آبی (1000-100میکرولیتر) استریل بدون Rnase/DNase Free رنگ بسته هزار عددی BT222-NS بسته هزار عددی ناموجود BioBasic
342 سر سمپلر زرد (200 میکرو لیتر) مدرج استریل بدون رنگ بسته هزار عددی Rnase/DNase Free BT224-NS بسته ناموجود BioBasic
343 رک سر سمپلر زرد (200 میکرو لیتر) مدرج استریل Rnase/DNase Free بدون رنگ BT224-RS Rack ناموجود BioBasic
344 سرسمپلر 300میکرولیتر، استریل  Rnase/DNase Free BT330-NS 1000 pcs ناموجود BioBasic
345 Rapid Blood RNA Isolation Kit BT4182 10preps ناموجود BioBasic
346 Rapid Blood DNA Extraction Kit BT4782 50preps ناموجود BioBasic
347 فالکون 15 BT888-SN بسته 100 تایی ناموجود BioBasic
348 15ML Centrifuge Tube, Screw Cap, Red, Sterile, 100/Bag BT888-SR SR ناموجود BioBasic
349 15ML Centrifuge Tube, Screw Cap, Yellow, Sterile, 100/Bag BT888-YS 100pcs ناموجود BioBasic
350 ترازو دقیق دیجیتالی (دقت یک صدم، ظرفیت 2100 گرم BTA2100D دستگاه ناموجود None
351 ترازو دقیق دیجیتالی (دقت یک هزارم، ظرفیت 210 گرم BTA210D دستگاه ناموجود None
352 (−)-cat_numberechin C0567 5MG ناموجود Sigma
353 (±)-cat_numberechin hydrate C1788 500MG ناموجود Sigma
354 Cesium chloride         C3032 25gr ناموجود Sigma
355 Acetylcholinesterase from Electrophorus electricus (electric eel) C3389 2KU ناموجود Sigma
356 Acetylcholinesterase from Electrophorus electricus (electric C3389-500U ناموجود None
357 Water C8801 500ml ناموجود BioBasic
358 Cyanogen bromide-activated-Sepharose® 4B 1g Sigma C9142 None ناموجود DUMMY
359 Calcium nitrate tetrahydrate, extra pure Ca(NO3)2·4H2O CA0230 1kg ناموجود Scharlau
360 Coomassie brilliant blue R-250    CB0037 25gr ناموجود BioBasic
361 Citric acid CB0055 1Kg ناموجود BioBasic
362 L-Cysteine CB0088-500g None ناموجود BioBasic
363 CTAB CB0108 100g ناموجود BioBasic
364 L-Cysteine CB0132 100gr ناموجود BioBasic
365 CELLBANKER 1plus CB022  20ml ناموجود TaKaRa
366 CELLBANKER 2 CB032  20ml ناموجود TaKaRa
367 Curcumin CB0346 5gr ناموجود BioBasic
368 Cytochrome C CB0354-100MG 100G ناموجود BioBasic
369 STEM-CELLBANKER CB042  20ml ناموجود TaKaRa
370 STEM-CELLBANKER CB044S  4ml ناموجود TaKaRa
371 STEM-CELLBANKER GMP grade CB047 4*20 ml ناموجود TaKaRa
372 Chitosan CB0660 100gr ناموجود BioBasic
373 Chitosan .SIZE.50G CB0660-50g None ناموجود BioBasic
374 Chlorocholine chloride CB0736 5G ناموجود BioBasic
375 Cresol red, free acid CD0037B 5gr ناموجود BioBasic
376 Calcium chloride, dihydrate CD0050-2.5kg 2.5kg ناموجود BioBasic
377 Cholesterol CD0122 50gr ناموجود BioBasic
378 Cytosine CD0138 10gr ناموجود BioBasic
379 Copper (II) sulfate pentahydrate CDB0063-400g ناموجود BioBasic
380 Carbenicillin disodium CDJ469.SIZE.5G None ناموجود BioBasic
381 CASEIN CN5204 500gr ناموجود BioBasic
382 تیوب ml50با درب بدون رنگ مخصوص سرعت بالا، استریل/بسته 25تایی  Rnase/DNase Free CT790-SN 25pcs ناموجود BioBasic
383 Agarose A D0012-250gr 250gr ناموجود BioBasic
384 Albumin,pH 5.1+0. D0024 50gr ناموجود BioBasic
385 Albumin,pH 5.1+0.2 10gr D0024-10G 10G ناموجود BioBasic
386 Albumin,pH 5.1+0.2 25gr D0024-25G 25G ناموجود BioBasic
387 Albumin, pH 5.1+0.2 5gr D0024-5G 5G ناموجود BioBasic
388 2'-Deoxythymidine-5'-triphosphate 100mM solution[dTTP], sodium salt D0046T 0-5ml ناموجود BioBasic
389 TSG DNA POLYMERASE, 5U/UL.SIZE. 200 u D0081-200u None ناموجود BioBasic
390 Dialysis tubing cellulose membrane23mm غشاء دیالیز با قطر 23mm (Molecular weight cut-off : 12400Da) D0405 1meter ناموجود Sigma
391 Dialysis tubing cellulose membrane32mm غشاء دیالیز با قطر 32mm (Molecular weight cut-off : 12400Da) D0530 1meter ناموجود Sigma
392 1,4-Diaminobutane D13208 100gr ناموجود Sigma
393 Diphenyl phosphite D210803 100gr ناموجود Sigma
394 Dimethyl sulfoxide (DMSO) Cell Culture Grade D2650-10ML 10ml ناموجود Sigma
395 Dansyl chloride D705183 1G ناموجود BioBasic
396 Dialysis tubing cellulose membrane10mm غشاء دیالیز با قطر 10mm (Molecular weight cut-off : 14KDa) D9277 1meter ناموجود None
397 Dialysis tubing cellulose membrane43mm غشاء دیالیز با قطر 43mm (Molecular weight cut-off : 14KDa) D9527 1meter ناموجود Sigma
398 DTNB, 5,5'-Dithiobis-(2-nitrobenzoic acid) DB0113-1g None ناموجود BioBasic
399 DAB, tetra hydrochloride DB0140 5gr ناموجود BioBasic
400 DAB, tetra hydrochloride DB0140 25gr ناموجود BioBasic
401 Dextran sulfate DB0160 10g ناموجود BioBasic
402 Sodium chloride DB0483 2.5kg ناموجود BioBasic
403 Doxycycline, hydrochloride DB0889 25gr ناموجود BioBasic
404 Doxycycline, hydrochloride DB0889-1g None ناموجود DUMMY
405 Doxycycline, hydrochloride DB0889-5g None ناموجود DUMMY
406 Deoxycholic acid, sodium salt DD0150 50G ناموجود BioBasic
407 DEPC Water DD1005 500ml ناموجود BioBasic
408 DNAfectamine DNAF001-0.1ML None ناموجود BioBasic
409 Eco-Stain . ready to use DT81413-1 ML 1ML ناموجود BioBasic
410 Benzonase® Nuclease E1014 25ku ناموجود Sigma
411 Benzonase® Nuclease E1014 5ku ناموجود Sigma
412 Elastase from human leukocytes E8140-1UN None ناموجود Sigma
413 EDTA , disodium salt , dihydrate EB0185 500gr ناموجود BioBasic
414 EDTA, disodium salt, dihydrateSIZE.100G EB0185-100G 100g ناموجود BioBasic
415 Ethidium bromide (EB; EtBr) EB0195 1gr ناموجود BioBasic
416 EDAC, hydrochloride EB0433 25g ناموجود BioBasic
417 EDAC, hydrochloride.SIZE.5G EB0433-5G 5g ناموجود BioBasic
418 Ethyl acetate Reagent EC4600 1lit ناموجود BioBasic
419 Ethylene glycol ED0199 250ml ناموجود BioBasic
420 Alu I ER0011 600U ناموجود Thermo
421 Thermo Scientific™ PstI (10 U/µL) ER0611 None ناموجود DUMMY
422 MnlI ER1071 None ناموجود Thermo
423 Fluorescein  diacetate F7378-10G None ناموجود None
424 Agar A FB0010-100G 100gr ناموجود BioBasic
425 Formamide deionized FB0211-500ml None ناموجود BioBasic
426 Fast Green FCF FB0452 5gr ناموجود BioBasic
427 Iron (III) sulfate, hydrate FD0208 250gr ناموجود BioBasic
428 Thermo Scientific™ FastDigest™ Bsp1407I FD0933 None ناموجود DUMMY
429 Formamide FDB0212 500ml ناموجود BioBasic
430 Formononetin 100 mg FF09317-100mg None ناموجود DUMMY
431 Sorafenib tosylate 500 mg FS10808 None ناموجود DUMMY
432 نوک کریستالی فیلتردارRnase & Dnase free- GEB FT0010-B-N None ناموجود DUMMY
433 نوک زرد فیلتردار Rnase & Dnase free- GEB FT0102-B-N None ناموجود DUMMY
434 رک سرسمپلرفیلتردار10-1/0 میکرو لیتراستریل رک 96 عددی  Rnase/DNase Free FT215-RNS رک 96 عددی ناموجود BioBasic
435 سرسمپلرفیلتردار100-10  میکرو لیتر بسته 1000 عددی FT224 1000pcs ناموجود BioBasic
436 10-100UL Filter Tip, Natural, Sterile, 96/Rack FT224-RNS رک 96 عددی ناموجود BioBasic
437 0.5-10UL FILTER TIP, NATURAL,1000/PACK FT225 ناموجود BioBasic
438 Gluglutaraldehyde G0875 25ml ناموجود BioBasic
439 Agar C G1253 500G ناموجود BioBasic
440 TRYPTONE POWDER .SIZE.500G G211(TG217)-500 G 500g ناموجود BioBasic
441 Peptone B SOY Protein G214 500G ناموجود BioBasic
442 Peptone F Lactalbumin Hydrolysate G256 500G ناموجود BioBasic
443 Guanidine Oxidized* G4375-1g None ناموجود DUMMY
444 Gelatin from bovine skin G9382-1KG None ناموجود DUMMY
445 Gelatin G9764 100gr ناموجود BioBasic
446 Gelatin.SIZE.50G G9764-50G 50g ناموجود BioBasic
447 D(+)Galactose GB0215 25gr ناموجود BioBasic
448 D-Glucose, monohydrate GB0218 500gr ناموجود BioBasic
449 D-Glucose, anhydrous Gb0219 1KG ناموجود BioBasic
450 Glutathione oxidized GB0228 1g ناموجود BioBasic
451 Glutathione reduced GB0229 5gr ناموجود BioBasic
452 Glutathione reduced GB0229 1gr ناموجود BioBasic
453 Guanidine hydrochloride, biotech GB0242 500G ناموجود BioBasic
454 Guanidine hydrochloride, biotech GB0242 100gr ناموجود BioBasic
455 Guanidine hydrochloride, reagent GB0243 500G ناموجود BioBasic
456 Guanidine thiocyanate, biotech GB0244 1KG ناموجود BioBasic
457 Guanidine thiocyanate, biotech GB0244 250G ناموجود BioBasic
458 Glycogen GB0301 1gr ناموجود BioBasic
459 G 418 sulfate GDJ958 1gr ناموجود BioBasic
460 Guanidine thiocyanate, ultra pure.SIZE.250G GDR0244 None ناموجود None
461 Guanidine thiocyanate, ultra pure.SIZE.1KG GDR0244 1KG ناموجود BioBasic
462 Amersham™ Hybond® P Western blotting membranes, PVDF GE10600021 1ea ناموجود Sigma
463 DEAE Sepharose® Fast Flow GE17-0709-10 25ml ناموجود GE Health Care
464 Percoll® PLUS GE17-5445-02 None ناموجود DUMMY
465 Gene synthesis 336bp Gene Synthesis AMINO073 None ناموجود BioBasic
466 Low MW DNA Marker A ready touse25,50,75,100,150,200,300,400,500bp GM303 20 loading ناموجود BioBasic
467 25-500bp Low Range DNA Marker A, Ready-to-use GM303-20 loading None ناموجود BioBasic
468 DNA Marker B, Ready-to-use 100-600bp Low Range DNA Marker B, Ready-to-Use 6 DNA fragments: 100, 200, 300, 400, 500, 600bp GM331 50 Loading ناموجود BioBasic
469 دسته هاون خردکننده بافت، مخروطی شکل GR111 100 loading ناموجود BioBasic
470 Adenovirus Fiber monomer and trimer antibody [4D2] GTX23233 None ناموجود DUMMY
471 CASP3 (Human) Recombinant Protein (P01) H00000836 P01-10ug ناموجود Abnova
472 IFNB1 purified MaxPab rabbit polyclonal antibody (D01P) H00003456 D01P-100ug ناموجود BioBasic
473 TRAF6 monoclonal antibody (M02), clone 1B2 H00007189 M02-50ug ناموجود Abnova
474 IL1R2 monoclonal antibody (M01), clone 1G12 H00007850 M01-100ug ناموجود Abnova
475 Hanks , Balanced Salts,Powder H2387 1lit ناموجود Sigma
476 6-Hydroxydopamine hydrochloride H4381 100mg ناموجود Sigma
477 Oligo synthesis HAP Purification OD2 H510001-0002 None ناموجود BioBasic
478 HEPES free acid SiZE.25gr HB0264 ناموجود BioBasic
479 HEPES, sodium salt HB0265 1KG ناموجود BioBasic
480 Histamine dihydrochloride HB0501 5gr ناموجود BioBasic
481 N-Hydroxysuccinimide HB0526 25G ناموجود BioBasic
482 N-Hydroxysuccinimide HB0526-10g 10g ناموجود BioBasic
483 N-Hydroxysuccinimide HB0526-20g ناموجود BioBasic
484 HCL -500ml-Acros HCL -500ml-Acros 500ml ناموجود BioBasic
485 8-Hydroxyquinoline (8-Quinolinol) HD0274 100G ناموجود BioBasic
486 4- Isothiocyanatophenyl α-D- Mannopyranoside I905135 100mg ناموجود TRC
487 Ice Pack IB003 Pack ناموجود BioBasic
488 IPTG IB0168 25gr ناموجود BioBasic
489 IPTG IB0168-100G 100g ناموجود BioBasic
490 Imidazole IB0277 100g ناموجود BioBasic
491 Imidazole IB0277 500g ناموجود BioBasic
492 myo-inositol IB0536.SIZE.500G None ناموجود BioBasic
493 Iodoacetamide IB0539 5gr ناموجود BioBasic
494 ICE PACK ICE None ناموجود BioBasic
495 Kanamycin sulfate -1gr K4000 None ناموجود Sigma
496 Keratinase K4519-500UN None ناموجود None
497 TNF (Human) ELISA Kit KA0191 1Kit ناموجود Abnova
498 Il6 (Rat) ELISA Kit KA0278 kit ناموجود Abnova
499 Tnf (Rat) ELISA Kit KA0280 1 Kit ناموجود Abnova
500 Bdnf (Mouse) ELISA Kit KA0331 1 Kit ناموجود Abnova
501 MMP2 (Human) ELISA Kit KA0391 kit ناموجود Abnova
502 Annexin V-FITC Apoptosis Kit KA0714 1 Kit ناموجود Abnova
503 Annexin V-FITC Apoptosis Kit (Premium) using SYTXO green dye and annexin V-FITC for apoptosis detection. KA0715 1 Kit ناموجود Abnova
504 Caspase-3 Assay Kit (Colorimetric) KA0740 kit ناموجود Abnova
505 LDH-Cytotoxicity Assay Kit KA0785 1Kit ناموجود Abnova
506 Ammonia Assay Kit KA0810 1Kit ناموجود Abnova
507 Glucose Assay Kit KA0831 1Kit ناموجود Abnova
508 MTT Cell Viability Assay Kit KA1606 Kit ناموجود Abnova
509 ATPase/GTPase Assay Kit KA1610 1Kit ناموجود Abnova
510 Caspase Substrate Assay Kit (Colorimetric) KA3694 Kit ناموجود Abnova
511 Kanamycin sulfate.SIZE.25G KB0286-25G 25gr ناموجود BioBasic
512 a-2-Ketoglutaric acid, disodium salt, dihydrate KD0289 100gr ناموجود BioBasic
513 Lipopolysaccharides from Escherichia coli O111:B4 L2630-10MG None ناموجود Sigma
514 Luteinizing Hormone from sheep pituitary L5269 Vial ناموجود Sigma
515 Lactoperoxidase from Bovine Milk L8257 25mg ناموجود Sigma
516 L-Lysine, monohydrochloride LB0171 250gr ناموجود BioBasic
517 Lithium dodecyl sulfate LB0569 25G ناموجود BioBasic
518 L-Leucine LB0922 500G ناموجود BioBasic
519 L-Leucine LB0922 100gr ناموجود BioBasic
520 Light green SF, Yellowish LD0007 25g ناموجود BioBasic
521 Lithium chloride, anhydrous LDB0307 250gr ناموجود BioBasic
522 Lysozyme LDB0308 100G ناموجود BioBasic
523 Lithium nitrate-Acros-250G Lithium nitrate-Acro 250G ناموجود BioBasic
524 500-10000bp DNA Marker, Ready-to-use M101R-1 SIZE.100 loading None ناموجود BioBasic
525 100 bp-10 Kb Wide Range DNA Logical Marker, Ready to use16 D M103R-1 100 LOADING ناموجود BioBasic
526 100bp-1.5kb DNA Ladder Marker J4 ready to use 100,200,300,400,500,600,700,800,900,1000,1500bp M107R-1 100 Loading ناموجود BioBasic
527 100-1500bp DNA Marker, Ready-to-use M107R-1.Size.100 loadings None ناموجود BioBasic
528 MTT M2128 1gr ناموجود Sigma
529 Myricetin 500MG M2131-500MG None ناموجود DUMMY
530 HSP70/HSP90AA1 monoclonal antibody,clone BB70 MAB2196 100ug ناموجود Abnova
531 MYD88 monoclonal antibody, clone 2E9C2 MAB2745 100ug ناموجود Abnova
532 Clostridium botulinum Toxin A monoclonal antibody, clone B36 MAB4095 1mL ناموجود Abnova
533 Clostridium botulinum Toxin B monoclonal antibody, clone B36 MAB4096 1mL ناموجود BioBasic
534 IL1R1 monoclonal antibody, clone BDI204 MAB4240 200ug ناموجود Abnova
535 Escherichia coli O157:H7 monoclonal antibody MAB5413 100ug ناموجود Abnova
536 5-Methylcytosine monoclonal antibody, clone 5MC-CD MAB6766 100ug ناموجود Abnova
537 MOPSO, free acid MB0234 25gr ناموجود BioBasic
538 Magnesium sulfate, heptahydrate, ACS MB0329 500G ناموجود BioBasic
539 D-Mannitol MB0335 500G ناموجود BioBasic
540 b-Mercaptoethanol MB0338 100ml ناموجود BioBasic
541 MES, free acid, monohydrate MB0341-500G 500g ناموجود BioBasic
542 Methylene blue, chloride, trihydrate MB0342 250G ناموجود BioBasic
543 L-Methionine MB0346-10G 10g ناموجود BioBasic
544 L-Methionine MB0346-5G 5g ناموجود BioBasic
545 MOPS, free acid MB0360 100gr ناموجود BioBasic
546 MOPS, free acid MB0360-500G 500G ناموجود BioBasic
547 Melatonin MB0605 25G ناموجود BioBasic
548 MES, sodium salt MB0611 50gr ناموجود BioBasic
549 25mM MgCl2 MB1193 1.5ml ناموجود BioBasic
550 D-(+) Maltose, monohydrate MB4950 100G ناموجود BioBasic
551 Methanol MC6700 500ml ناموجود BioBasic
552 Mitomycin C MD0356M 10mg ناموجود BioBasic
553 Lambda DNA MDD22 100ug ناموجود BioBasic
554 Gibco™ EpiLife™ Medium. with 60µM calcium MEPI500CA None ناموجود DUMMY
555 Gibco™ EpiLife™ CF Kit MEPICF500 None ناموجود DUMMY
556 Maltose, monohydrate MIB1184 500G ناموجود BioBasic
557 Maltose, monohydrate MIB1184 100g ناموجود BioBasic
558 Premix WST-1 Cell Proliferation Assay System MK400 2500test ناموجود TaKaRa
559 LDH Cytotoxicity Detection Kit MK401 2,000 Tests ناموجود TaKaRa
560 Apoptosis Assay: In situ Apoptosis Detection Set MK500 20 Assays ناموجود TaKaRa
561 ApopLadder Ex MK600 ناموجود TaKaRa
562 Magnesium chloride, hexahydrate MRB0328 250gr ناموجود BioBasic
563 NADPH N1630 None ناموجود DUMMY
564 N?-Nitro-L-arginine methyl ester hydrochloride N5751-250MG None ناموجود DUMMY
565 Nisin from Lactococcus lactis-1gr N5764 None ناموجود DUMMY
566 Nutrient Mixture F-10 Ham N6635-10L None ناموجود DUMMY
567 β-Nicotinamide adenine dinucleotide 2′-phosphate reduced tetrasodium salt hydrate N7505 25mg ناموجود Sigma
568 pNPP-Na NB0365 5gr ناموجود BioBasic
569 Nystatin NB0390 25gr ناموجود BioBasic
570 NADH disodium salt, trihydrate, Reduced NB0642-5G 5g ناموجود BioBasic
571 N-(1-Naphthyl)-ethylenediamine dihydrochloride NB0650-10G 10g ناموجود None
572 Non-Fat Powdered Milk NB0669-100G 100g ناموجود BioBasic
573 Non-Fat Powdered Milk NB0669-50G 50g ناموجود BioBasic
574 ONPG (2-Nitrophenyl β-D-galactopyranoside) ND0382 1gr ناموجود BioBasic
575 Nitrotetrazolium blue chloride (NBT) NDB0379 5gr ناموجود BioBasic
576 Nitrotetrazolium blue chloride (NBT).SIZE.5G NDB0379-5G 5g ناموجود BioBasic
577 Nitrocellulose Membrane NT020S1-5(20X20CM) ناموجود BioBasic
578 Ovalbumin, purified O705084 1gr ناموجود BioBasic
579 L-alfa-Phosphatidylethanolamine, dioleoyl* P1223-25MG None ناموجود Sigma
580 pH Standard solution, Red pH 4.0 P2304-100ML 100ML ناموجود BioBasic
581 pH Standard solution, pH 7.0 P2307-100ML 100ML ناموجود BioBasic
582 pH Standard solution pH9.0 P2309-100ML 100ML ناموجود BioBasic
583 CA2 (Human) Recombinant Protein P3488 100ug ناموجود Abnova
584 ADIPOQ (Human) Recombinant Protein P3520 100ug ناموجود Abnova
585 Poly galactrunic acid   P3889 100gr ناموجود Sigma
586 Potassium phosphate monobasic P5379 500gr ناموجود Sigma
587 Turbo3C Protease P5380 1mg ناموجود Abnova
588 Phenylmethanesulfonyl fluoride (PMSF) P7626 250mg ناموجود Sigma
589 Escherichia coli O157:H7 polyclonal antibody PAB13942 1mg ناموجود Abnova
590 Donkey Anti-Human IgG (H&L) secondary antibody PAB9276 2mg ناموجود Abnova
591 L-Phenylalanine PB0422 100gr ناموجود BioBasic
592 PMSF PB0425 5g ناموجود BioBasic
593 PEG 8000 PB0433 500gr ناموجود BioBasic
594 PEG 8000 .SIZE.100G PB0433-100g None ناموجود BioBasic
595 Potassium hydroxide PB0441 500gr ناموجود BioBasic
596 Potassium iodide   PB0443 50gr ناموجود BioBasic
597 Proteinase K PB0451.SIZE.1G 1g ناموجود BioBasic
598 Pancreatin-5.0 (5XUSP)from hog pancreas PB0680 100gr ناموجود BioBasic
599 Pepsin 1: 10,000 PB0688 100gr ناموجود BioBasic
600 Phytagel PB0714-50G 50G ناموجود BioBasic
601 PIPES, free acid PB0719 100g ناموجود BioBasic
602 Paraffin oil (Mineral oil), light fraction PC5530 100ml ناموجود BioBasic
603 Paraffin oil (Mineral oil), heavy fraction PC5531 100ml ناموجود BioBasic
604 Pyridine PC8700 1lit ناموجود BioBasic
605 10x Taq Buffer (MgCl2) PCRB16 1.5ml ناموجود BioBasic
606 10x Taq Buffer (NH4)2SO4 PCRB55 1.5ml ناموجود BioBasic
607 10x PCR Buffer PCRB60 1.5ml ناموجود BioBasic
608 PBS (Phosphate BuffeRed Saline), powdered PD0100 1PK ناموجود BioBasic
609 Pyridoxal-5"-phosphate. monohydrate PD0455-5g None ناموجود BioBasic
610 Phenol-100cc-Sciense Phenol-100cc-Sciense 100cc ناموجود BioBasic
611 Valproic acid PHR1061-1G 1g ناموجود None
612 Slide-A-Lyzer® Dialysis Cassettes and Kits, MWCO 3500 to 10000 PI66330 cassette ناموجود Thermo
613 Puromycin, dihydrochloride .SIZE.25MG PJ593 ناموجود BioBasic
614 One-Tube Plant Genomic DNA Extraction Kit PT71816 100preps ناموجود BioBasic
615 MRS Broth- Qlab- 100g QB-65-2285 None ناموجود DUMMY
616 Green-2-Go 1-Step TaqProbe qRT-PCR Mastermix-no Dye(100x20ul Rxn) QPCR008-NODYE.100 None ناموجود BioBasic
617 TaKaRa Taq™ DNA Polymerase R001A 250 Units ناموجود TaKaRa
618 TaKaRa Taq™ DNA Polymerase (with Mg2+ free buffer) R001AM 250 Units ناموجود TaKaRa
619 Pyrobest™ DNA Polymerase R005A 125 U ناموجود TaKaRa
620 PrimeSTAR® HS DNA Polymerase R010A 250 Units ناموجود TaKaRa
621 PCR Amplificat_numberion Kit R011 100 Rxns ناموجود TaKaRa
622 رک 11 خانه مخصوص تیوب سانتریفیوژ R011-N Pack ناموجود BioBasic
623 رک 12 خانه مخصوص تیوب سانتریفیوژ R012-N Pack ناموجود BioBasic
624 رک 24 خانه مخصوص تیوب سانتریفیوژ R024-N Pack ناموجود BioBasic
625 PrimeSTAR® GXL DNA Polymerase R050A 250 Units ناموجود TaKaRa
626 PrimeSTAR® GXL DNA Polymerase R050Q 50 Units ناموجود TaKaRa
627 Xcm I R0533S 1000U ناموجود NEB
628 Methylation Specific PCR: EpiScope MSP Kit R100A 200 Rxns ناموجود TaKaRa
629 رک 96 خانه 5 لایه مخصوص سرسمپلر 200میکرولیتر قابل اتوکلاو با کاور RA225-5LR 5*96rack ناموجود BioBasic
630 رک مخصوص سرسمپلر زرد RA226BR rack ناموجود BioBasic
631 رک میکروتیوب0.2درب لولایی رک153خانه- Globall Roll Rack0.2 None ناموجود DUMMY
632 رک میکروتیوب0.5درب لولایی رک98خانه- Globall Roll Rack0.5 None ناموجود DUMMY
633 رک میکروتیوب1.5درب لولایی رک72خانه- Globall Roll Rack1.5 None ناموجود DUMMY
634 RNase A RB0473-100mg None ناموجود BioBasic
635 RNase A Solution (10mg/m.SIZE.1MLl) RB0474 ناموجود BioBasic
636 Ribonuclease inhibitor RB0478 5ku ناموجود BioBasic
637 Fibroblast Growth Factor-Basic ; human FGF-basic RC215 13-10UG ناموجود BioBasic
638 Epidermal Growth Factor; human EGF RC216 15-100UG ناموجود BioBasic
639 Vascular Endothelial Growth Factor 165; human VEGF165 RC216-16 10ug ناموجود BioBasic
640 Interleukin-4 . murine IL-4 RC232-15.Size.20ug None ناموجود BioBasic
641 Riboflavin RD0470 100gr ناموجود BioBasic
642 Plastic Foam Racks, Octagonal, 83X12MM RF024 83X12MM ناموجود BioBasic
643 Plastic Foam Racks, Circle 83X12MM RF025 83X12MM ناموجود BioBasic
644 Plastic Foam Racks, Triangle, 86X12MM RF026 86X12MM ناموجود BioBasic
645 TaKaRa Ex Taq® DNA Polymerase RR001A 250unit ناموجود TaKaRa
646 A High Fidelity PCR Enzyme for Long Range PCR: LA Taq DNA Polymerase RR002A 125 Units ناموجود TaKaRa
647 TaKaRa LA Taq® DNA Polymerase (Mg2+ plus buffer) RR002M 250 Units ناموجود TaKaRa
648 PrimeScript RT-PCR Kit RR014A Kit ناموجود TaKaRa
649 TaKaRa Ex Taq Mg2+ free buffer RR01AM 250u ناموجود TaKaRa
650 PrimeScript™ RT Reagent Kit Fast, efficient synthesis of 1st strand cDNA ready for Real Time RR037A 200 react ناموجود TaKaRa
651 PrimeScript™ RT Reagent Kit Fast, efficient synthesis of 1st strand cDNA ready for Real Time RR037Q 20 react ناموجود TaKaRa
652 One Step RT-PCR Kit Ver. 2 RR055A 50 react ناموجود TaKaRa
653 Multiplex PCR Assay Kit Ver.2 RR062A 100 Rxns ناموجود TaKaRa
654 One Step PrimeScript™ RT-PCR Kit. (Perfect Real Time) RR064A 100 react ناموجود TaKaRa
655 One-Step SYBR® PrimeScript™ RT-PCR Kit (Perfect Real Time) RR066A 100 Rxns ناموجود TaKaRa
656 SpeedSTAR™ HS DNA Polymerase RR070Q 50 Units ناموجود TaKaRa
657 One Step SYBR PrimeScript RT-PCR Kit II RR086A 100 react ناموجود TaKaRa
658 SYBR® Premix DimerEraser™ (Perfect Real Time) RR091A 200 Rxns ناموجود TaKaRa
659 EmeraldAmp GT PCR Master Mix RR310A 4ml ناموجود TaKaRa
660 EmeraldAmp GT PCR Master Mix RR310Q 1ml ناموجود TaKaRa
661 EmeraldAmp Max PCR Master Mix RR320A 4ml ناموجود TaKaRa
662 EmeraldAmp Max PCR Master Mix RR320Q 1ml ناموجود TaKaRa
663 EmeraldAmpMaxHS PCR Master Mix - (RR330A) RR330A 4ml ناموجود TaKaRa
664 EmeraldAmp Max HS PCR Master Mix RR330A 4ml ناموجود TaKaRa
665 EmeraldAmp MAX HS PCR master mix RR330Q 1 ml  ناموجود TaKaRa
666 SapphireAmp Fast PCR Master Mix RR350A 4 ml ناموجود TaKaRa
667 SapphireAmp Fast PCR Master Mix RR350Q 1 ml ناموجود TaKaRa
668 Premix Ex Taq (Probe qPCR) RR390L 5ml ناموجود TaKaRa
669 Premix Ex Taq (Probe qPCR) (TaqMan) RR390Q 1ml ناموجود TaKaRa
670 SYBR Green Master Mix: SYBR Premix Ex Taq II (Tli RNase H Plus) RR820A 200 Rxns ناموجود TaKaRa
671 SYBR Premix Ex Taq II (Tli Plus) RR820L 5ml ناموجود TaKaRa
672 SYBR Premix Ex Taq II (Tli Plus) RR820Q 1ml ناموجود TaKaRa
673 SYBR Premix Ex Taq2 (Tli Plus) 25ml RR820W 25ml ناموجود TaKaRa
674 DNA,RNA-EZ E1 (RNA-Be-Locked) Solution- Tissue (RNA Later) RT4171 25ML ناموجود BioBasic
675 Gibco™ Human Keratinocyte Growth Supplement (HKGS) S0015 None ناموجود DUMMY
676 Sodium thioglycolate S0265 25G ناموجود BioBasic
677 سل شیشه ای استاندارد فلورومتر با درب S204-G Pack ناموجود BioBasic
678 YNB, WO Aminon acid & Ammonium Sulfate S505 100G ناموجود BioBasic
679 YNB, WO AMINO ACIDS.SIZE.100G S507 100gr ناموجود BioBasic
680 Sodium sulfate, anhydrate SB0298 2.5KG ناموجود BioBasic
681 D-Sorbitol .SIZE.500G SB0491 ناموجود BioBasic
682 Safranin O SB0815 25gr ناموجود BioBasic
683 Sodium diphenylamine-4-sulfonate SB0847.SIZE.100G None ناموجود BioBasic
684 Sodium orthovanadate, dodecahydrate SB0869 25G ناموجود BioBasic
685 Sodium sulfite, anhydrate SB0892 500G ناموجود BioBasic
686 Spectinomycin dihydrochloride SB0901 5gr ناموجود BioBasic
687 Spectinomycin dihydrochloride SB0901 25gr ناموجود BioBasic
688 Spectinomycin dihydrochloride .SIZE.25G SB0901 ناموجود BioBasic
689 Millieu de transfection des Plasmides sc-108062 None ناموجود DUMMY
690 Réactif de Transfection Ultracruz® sc-395739 None ناموجود DUMMY
691 Plasmide CRISPR/Cas9 KO Heme Oxygenase 1 (h) sc-400157 None ناموجود DUMMY
692 Plasmid HDR Heme Oxygenase 1 (h) sc-400157-HDR None ناموجود DUMMY
693 Plasmide de Contrôle CRISPR/Cas9 sc-418922 None ناموجود DUMMY
694 EZ-10 Column & collection tube (bluetube, clear ring, clear SD5005-100 None ناموجود BioBasic
695 EZ-10 RNA Column & collectiontube(clear tube, clear ring, cl SD5008-100 None ناموجود BioBasic
696 LB Broth, Miller SD7002(S518) 250gr ناموجود BioBasic
697 YT Top Agar SD7018-250g None ناموجود BioBasic
698 2x YT Broth SD7019-250g None ناموجود BioBasic
699 Sodium lauroyl sarcosine SDB0486 250g ناموجود BioBasic
700 Sodium lauroyl sarcosine SDB0486-100g None ناموجود