لیست محصولات

×

آیا سوالی دارید؟ با ما تماس بگیرید.تلفن: (021)44260285(4 خط) - تلگرام: +989391127651

محصولات موجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 پرل شيشه ايي-250gr 250g 950,000 ایرانی
2 پتري ديش 3.5 کشت سلول استريل عدد 350,000 Jetbiofil
3 Nitric Acid 2.5lit 4,500,000 Scharlau
4 پليت 4خانه نچسب استريل عدد 300,000 Jetbiofil
5 شيشه رنگ آميزي لام 350,000 None
6 Copper Nitrate 250gr 2,500,000 Acros
7 Ammonium Sulfate 100G 1,800,000 Acros
8 مگنت سایز 2 65,000 None
9 Serafol 2,500,000 Serafol
10 Rox I 40 ul 1,200,000 TaKaRa
11 رک نوک زرد همراه نوک 450,000 چینی
12 فيلتر سرسرنگي 0.22 استریل تک عددي عدد 180,000 MS
13 استراپر 250,000 None
14 فيلتر سرسرنگي 0.45 استریل تک عددي عدد 180,000 MS
15 رک نوک کريستالي خالي عدد 450,000 چینی
16 پليت 12 خانه استريل - None 190,000 SPL
17 Rox II - 100µl 1,200,000 TaKaRa
18 دي سديم هيدروژن فسفات 1Kg Acros - None 3,950,000 Acros
19 Buffer H 1000 None 600,000 TaKaRa
20 Buffer BSA 1000 1ml 600,000 TaKaRa
21 Buffer Triton X100 1000 1ml 600,000 TaKaRa
22 Apa I 1005A 10000u 9,950,000 TaKaRa
23 BOD Cell Test (BSB) 1.00687.0001 50 T 9,800,000 Merck
24 Bgl I 1000 units 1020A 1000U 4,500,000 TaKaRa
25 Dra I AhaIII 4000u TakaRa 1037A 4000u 9,950,000 TaKaRa
26 Mbo I 1069A 1000u 7,500,000 TaKaRa
27 Paraffin 107300 1kg 4,500,000 Merck
28 Hydroxyurea 10872383-1G 1g 3,950,000 Molekula
29 EcoT22I (AvaIII) 1125A 2000 u 9,500,000 TaKaRa
30 BspT104 (Asu II, Nsp V) 1225A 2500 u 7,950,000 TaKaRa
31 Sodium Carbonate 131648 1kg 2,950,000 Panreac
32 Vindoline 13940871-5MG None 5,950,000 Molekula
33 Syringic acid 14539311-10g 10g 4,950,000 Molekula
34 Syringic acid 14539311-1g 1g 1,500,000 Molekula
35 Syringic acid 14539311-25g 25g 9,500,000 Molekula
36 Syringic acid 14539311-50g 50g 15,500,000 Molekula
37 Salicylic acid-100g 17820272-100g None 1,200,000 Molekula
38 Salicylic acid-250g 17820272-250g None 2,750,000 Molekula
39 Sillicon Cloride-500ml 201165000 500ml 8,950,000 Acros
40 Ribonuclease H (RNase H) 1000units TaKaRa 2150A 1000U 8,950,000 TaKaRa
41 Imidazole 21611083-100g 100g 4,950,000 Molekula
42 Dodecyl-beta-D-maltoside (DDM) 21771928-1G 1g 6,950,000 Molekula
43 رک نوک فیلتردار Rnase & Dnase free 0.5-10ul-Orange 2502000 None 800,000 Orange
44 رک نوک فیلتردار Rnase & Dnase free- 1-100ul- Orange 2502025 None 800,000 Orange
45 رک نوک فیلتردار Rnase & Dnase free 1000ul- Orange 2502041 None 980,000 Orange
46 نوک کریستالی Rnase&Dnase& pyrogen free-1000pcs- Orange 2502050 None 3,950,000 Orange
47 نوک زرد فیلتردارRnase & Dnase free-Orange 2502100 None 3,950,000 Orange
48 ميکرو تيوب 0.2 Rnse Free بسته 1000عددي Orange 25500 None 2,950,000 Orange
49 BcaBEST DNA Polymerase 300U 2770Q 300u 2,950,000 TaKaRa
50 پلیت 48خانه استریل Rnase & Dnase free-SPL 30048 None 190,000 SPL
51 pUC 19 DNA 3219 None 12,500,000 TaKaRa
52 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-10g 10g 2,950,000 Molekula
53 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-50g 50g 7,950,000 Molekula
54 100 bp DNA ladder 3407A 100 Rxns 16,950,000 TaKaRa
55 500 bp DNA ladder 3411A 50 µg 16,950,000 TaKaRa
56 Poly(vinyl alcohol)-25gr 363065-25G 25g 9,500,000 Sigma
57 4-Imidazolecarboxylic acid 425842 1gr 19,500,000 Sigma
58 DAB-Am-4,Polypropylenimine tetramine dendrimer, generation 1 460699 5ml 35,000,000 BioBasic
59 Curcumin-5g 49256996-5g None 4,500,000 Molekula
60 لوله فالکون 50 استريل RNase & DNase Freeبسته 25عددي 50050 None 975,000 SPL
61 ABTS (2.2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)diammonium salt) 51808824-1G 14,950,000 Molekula
62 Resveratrol 51852282-100MG None 4,500,000 Molekula
63 Tannic acid 52612564-100G 100g 3,500,000 Molekula
64 Tannic acid 52612564-250G 250g 6,500,000 Molekula
65 Tannic acid 52612564-50G 50g 2,500,000 Molekula
66 Resazurin sodium salt 56554686-1G 1g 3,950,000 Molekula
67 Fluorescamine 57916662-100MG 100mg 8,950,000 Molekula
68 Tet System Approved FBS 631107-50ML None 19,800,000 TaKaRa
69 Universal GenomeWalker 2.0 636405 None 180,000,000 TaKaRa
70 SeqAmp DNA Polymerase 638504 None 22,000,000 TaKaRa
71 CloneAmp HiFi PCR Premix 639298-50rxns None 5,500,000 TaKaRa
72 فلاسک کشت سلول 175cm فيلتردار استريل بسته5 عددي 71175 None 1,425,000 SPL
73 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-1G None 1,950,000 Molekula
74 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-5G 2,950,000 Molekula
75 1,3-Dibromopropane 803279-100ml 100ml 12,500,000 Sigma
76 Topotecan hydrochloride 85474031-25MG 25mg 25,000,000 Molekula
77 Quercetin 86015335-100mg None 3,950,000 Molekula
78 Quercetin 86015335-500mg 500mg 8,500,000 Molekula
79 Catharanthine 89985253-5MG None 5,950,000 Molekula
80 SUPREC-01 (Rapid Recovery of DNA from Agarose Gels) 9040 100T 12,500,000 TaKaRa
81 پی پت 5 استریل-SPL 91005 None 30,000 SPL
82 پی پت 10 استریل-SPL 91010 None 58,000 SPL
83 10X Takara Taq Buffer (Mg2+ free) 9151AM-1ML None 1,950,000 TaKaRa
84 2X GC Buffer I 9154-1.5ml None 1,500,000 TaKaRa
85 GC Buffer II 9155 1.25ml 1,500,000 TaKaRa
86 Loading buffer 6X 9156 vials 950,000 TaKaRa
87 Loading buffer 10 X 9157 vials 950,000 TaKaRa
88 Esay Dilution 1 pak 9160 1ml 25,000,000 TaKaRa
89 Plant DNA Isolation Reagent 9194 100T 12,500,000 TaKaRa
90 NucleoCassette™ 941-0002 Pack 29,500,000 NucleoCassette
91 TBE buffer (Tris-Borate-EDTA), primix powder A0014 1PK 2,500,000 BioBasic
92 TAE buffer 25x solution A0023 1L 4,950,000 BioBasic
93 10X TBE A00269 500ML 1,950,000 BioBasic
94 TBS buffer . 10x Solution A0027-4L None 6,950,000 BioBasic
95 Arsenic(III) oxide A1010 25gr 9,500,000 Sigma
96 دی آمونیوم هیدروژن فسفات A2301 500gr 1,950,000 Applichem
97 Amoxicillin, trihydrate A762203 5gr 2,500,000 BioBasic
98 Abscisic acid (Dormin, ABA) (+) AB0001 100mg 6,950,000 BioBasic
99 Acetylcholine chloride AB0002 5G 2,500,000 BioBasic
100 ADA buffer disodium salt Ab0005-25g None 3,500,000 BioBasic
101 Alizarin yellow GG AB0011 25gr 1,950,000 BioBasic
102 Alizarin yellow R AB0012 25gr 1,950,000 BioBasic
103 Agarose M AB0013 50gr 4,500,000 BioBasic
104 Agarose B, low EEO AB0014 50 gr 5,500,000 BioBasic
105 Alkali blue 6B AB0016 25gr 3,600,000 BioBasic
106 Adenosine 5-triphosphate(ATP) disodium salt AB0020 5g 2,500,000 BioBasic
107 Ammonium bicarbonate AB0032 500gr 2,500,000 BioBasic
108 Ammonium bicarbonate AB0032-100G None 950,000 BioBasic
109 4-Aminoantipyrine AB0033-100G 100G 5,300,000 BioBasic
110 Ammonium bromide AB0057 250gr 2,950,000 BioBasic
111 Ammonium carbonate AB0058 500gr 2,550,000 BioBasic
112 Ammonium citrate, dibasic AB0059 500gr 3,300,000 BioBasic
113 Ammonium citrate, tribasic AB0060 250gr 2,250,000 BioBasic
114 Ampicillin, trihydrate AB0064-1G None 950,000 BioBasic
115 Ampicillin, trihydrate AB0064-5G None 2,500,000 BioBasic
116 Ammonium iron(II) sulfate hexahydrate AB0065 500gr 3,500,000 BioBasic
117 Ammonium molybdate tetrahydrate AB0067 50gr 1,500,000 BioBasic
118 Ammonium oxalate hydrate Ab0070-500g None 5,500,000 Molekula
119 D-Arabinose AB0071D 25G 4,500,000 BioBasic
120 L-Arabinose AB0071L 25gr 5,500,000 BioBasic
121 Ammonium phosphate, tribasic trihydrate AB0073 500G 2,500,000 BioBasic
122 Anthraquinone AB0087 25G 2,500,000 BioBasic
123 Anthrone AB0088 25gr 4,500,000 BioBasic
124 Anthrone AB0088-1G None 950,000 BioBasic
125 Anthrone AB0088-5g 1,500,000 BioBasic
126 L-Aspartic acid AB0091 250G 2,500,000 BioBasic
127 L-Arginine free base AB0205 100g 4,500,000 BioBasic
128 L-Arginine, monohydrochloride AB0206 100g 3,950,000 BioBasic
129 L-Arginine, monohydrochloride AB0206 500g 13,500,000 BioBasic
130 Acetamide AB0687-100g None 1,950,000 BioBasic
131 Acetosyringone AB1111 1g 7,500,000 BioBasic
132 N-Acetyl-D-glucosamine AB2245 25gr 2,500,000 BioBasic
133 Acriflavine hydrochloride AB4433 25G 3,950,000 BioBasic
134 N-Acetyl-L-Cysteine AB6697-5g None 1,950,000 BioBasic
135 Aniline AC1710 100ML 5,400,000 BioBasic
136 ADA buffer AD0003-25g None 2,950,000 BioBasic
137 ACES Ad0004-25g None 2,950,000 BioBasic
138 Acriflavine, neutral AD0009 25G 3,500,000 BioBasic
139 Adenine AD0013 25gr 2,950,000 BioBasic
140 L-Alanine AD0022 100gr 3,950,000 BioBasic
141 L-Alanine .SIZE.10G AD0022-10G 10g 950,000 BioBasic
142 L-Alanine .SIZE.50G AD0022-50G 50g 2,950,000 BioBasic
143 Adenine sulphate, dihydrate AD0028 25G 3,200,000 BioBasic
144 Amphotericin B AD0030P 1g 4,500,000 BioBasic
145 BSA Standard, 0.5mg/ml AD0069 2ml 1,500,000 BioBasic
146 Ammonium acetate ADB0032 500gr 2,250,000 BioBasic
147 Ammonium chloride ADB0034-250g None 1,300,000 BioBasic
148 Ammonium phosphate, dibasic ADB0040 500gr 4,350,000 BioBasic
149 Ammonium phosphate,  monobasic ADB0042 500gr 4,350,000 BioBasic
150 BSA Standard Solution AJ642.SIZE.1ML None 1,950,000 BioBasic
151 Ammonium acetate AR0032 500gr 2,550,000 BioBasic
152 AUTOCLAVE INDIcat_numberOR TAPES AT011.1ROLLS 1Rol 3,950,000 BioBasic
153 PFU DNA Polymerase, 5U/UL B0093 100u 5,950,000 BioBasic
154 PFU DNA POLYMERASE, 5U/UL.SIZE.500U B0093(D0090P)-500U None 19,500,000 BioBasic
155 Polyoxyethylene Lauryl Ether-35 (Brij 35) B0217-250G 250G 3,950,000 BioBasic
156 Bismuth (III) citrate B0466 100G 1,950,000 BioBasic
157 Imidazole – 4-carboxaldehyde 97% B25050 5gr 19,500,000 AlfaAesar
158 Bis-acrylamide BB0025 50g 3,950,000 BioBasic
159 Bis-acrylamide BB0025 250gr 17,500,000 BioBasic
160 Bis-acrylamide.SIZE.10G BB0025-10G None 1,300,000 BioBasic
161 Bromothymol blue, free acid BB0043 5G 1,650,000 BioBasic
162 BCIP toluidine salt BB0072 100MG 4,500,000 BioBasic
163 Bis-Tris BB0079 25gr 2,500,000 BioBasic
164 Bis-Tris BB0079-100gr 100gr 7,950,000 BioBasic
165 X-Gal BB0083 100mg 2,950,000 BioBasic
166 X-Gal BB0083.SIZE.5G 5gr 49,000,000 BioBasic
167 Bacitracin zinc BB0113 5g 2,950,000 BioBasic
168 Beef Extract BB0114-100g 100G 3,200,000 BioBasic
169 Barium acetate BB0116 250G 3,950,000 BioBasic
170 Benzamide BB0122 100gr 2,500,000 BioBasic
171 Benzimidazole BB0125 25gr 1,800,000 BioBasic
172 Berberine chloride BB0129.SIZE.5G None 4,500,000 BioBasic
173 BES, free acid BB0130 25G 2,700,000 BioBasic
174 BES, monosodium salt BB0131 25G 3,850,000 BioBasic
175 Betaine hydrochloride BB0133 250gr 4,950,000 BioBasic
176 Brilliant green BB0242 25gr 1,500,000 BioBasic
177 Bromocresol purple, free acid BB0244 25G 4,950,000 BioBasic
178 Bicine BB0266 100G 4,500,000 BioBasic
179 Bromocresol purple, sodium salt BB0627 5gr 1,500,000 BioBasic
180 6-Benzylamino purine BB0743-25G None 3,950,000 BioBasic
181 Basic fuchsin, certified BB1111 5gr 1,500,000 BioBasic
182 Benzoic acid BB1147 250gr 2,500,000 BioBasic
183 Bromophenol blue BB2230 25g 3,950,000 BioBasic
184 Benzaldehyde BC2140 500G 6,950,000 BioBasic
185 Bromothymol blue, sodium salt BD0048 5G 1,800,000 BioBasic
186 Bromocresol green, free acid BD0159 5G 2,950,000 BioBasic
187 1-Butanesulfonic acid sodium salt BD1237 5G 3,950,000 BioBasic
188 Bromophenol blue, sodium salt BDB0001 25g 4,500,000 BioBasic
189 تیوب 0.2میلی لیتر پی سی آر ، با درب صاف ،استریل،10 Rnase/DNase Free بسته 1000 BP541-S100 بسته 4,500,000 BioBasic
190 تیوب 0.2میلی لیتر پی سی آر ، با درب محدب ،استریل،10 Rnase/DNase Free بسته 1000 عددی BP542-S100 بسته 4,500,000 BioBasic
191 96 Well 2ml Deep Plate, Natural, Edge Filled, 10 P BR581-96N None 3,950,000 BioBasic
192 96 Well 2ml Deep Plate, Natural, Edge Filled, BR581-96N None 450,000 BioBasic
193 96 Well 2ml Deep Plate, Natural, Edge Filled, Sterile, 10 P BR581-96NS 96NS 4,950,000 BioBasic
194 EZ-10 Spin Column Total RNA Mini-preps Kit BS1361 50preps 9,950,000 BioBasic
195 DNA Blunting & Ligation Kit BS243-10 Preps None 7,950,000 BioBasic
196 EZ-10 Spin Column DNA Gel Extraction Kit BS353 50 preps 6,500,000 BioBasic
197 EZ-10Spin Column PCR Products Purification Kit 100preps BS364-100preps None 9,950,000 BioBasic
198 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS413 50preps 6,500,000 BioBasic
199 Fast DNA Ligation Kit(5U/UL,T4) 10RXN BS511-10RXN None 4,500,000 BioBasic
200 EZ-10 Spin Column Total RNA Mini-Preps Super Kit BS583 20preps 5,950,000 BioBasic
201 Penicillin / Streptomycin / Amphotericin B, sterile BS733 10ml 1,100,000 BioBasic
202 EZ-DNA Reagents BS8202 100 Preps 8,950,000 BioBasic
203 EZ-10 Spin Column Plant RNA Mini-Preps Kit BS82314 50preps 13,500,000 BioBasic
204 EZ-10 Spin Column Yeast DNA Mini-Preps Kit BS8257 50 PREPS 9,950,000 BioBasic
205 Rapid Bacteria RNA Isolation Kit BS8625 50preps 6,950,000 BioBasic
206 All-In-one DNA/RNA/Protein Miniprep Kit BS88003 50preps 18,500,000 BioBasic
207 EZ-10 DNAaway RNA Mini-Preps Kit BS88133-50 PREPS None 18,500,000 BioBasic
208 All-In-One DNA/RNA Miniprep Kit BS88203 50preps 16,500,000 BioBasic
209 One-4-ALL Genomic DNA Miniprep Kit BS88503 50preps 15,500,000 BioBasic
210  EZ-10 Total RNA Miniprep Kit BS88583 50preps 13,500,000 BioBasic
211 EZ-10 Spin Column RNA Cleanup & Concentration Kit.SIZE.50 Pre BS91315-50prep 50Prep 11,500,000 BioBasic
212 Membrane,Nuclear & CyToplasmic Protein Extraction Kit BSP002 50preps 13,950,000 BioBasic
213 One Step Plant Active Protein Extraction Kit BSP004-20PREPS None 12,000,000 BioBasic
214 TCA Protein Precipitation Kit BSP011-50 Preps None 5,950,000 BioBasic
215 Universal Protein Sediment Reagent BSP012-100 Preps None 5,950,000 BioBasic
216 Bacterial Protein Lysis Buffer, 1x Stength Solution BSP023-25ML None 4,500,000 BioBasic
217 رک سرسمپلرکریستالی کوتاه (10-1/0 میکرو لیتر)استریل رک 96 عددی BT215-RS رک 96 عددی 580,000 BioBasic
218 رک سرسمپلرکریستالی متوسط (10-2/0 میکرو لیتر)استریل رک 96 عددی Rnase/DNase Free BT216-RS رک 96 عددی 580,000 BioBasic
219 سرسمپلرکریستالی متوسط (10-2/0 میکرو لیتر)استریل Rnase/DNase Free BT216-S 1000pcs 1,800,000 BioBasic
220 0.2-10ul Micro Tips, MEDI,100/Pack,Sterile BT216-S-100 None 200,000 BioBasic
221 سرسمپلر آبی 1000-100میکرولیتر استریل-بسته 1000 عددی Rnase/DNase Free BT222-BS بسته 2,950,000 BioBasic
222 رک سر سمپلر آبی (100-1000) رک 100 خانه استریل RNase & DNase Free BT222-RS رک 100عددی 750,000 BioBasic
223 رک سر سمپلر زرد (200 میکرو لیتر) مدرج استریل Rnase/DNase Free BT224-RS , Rack BT224-RNS رک 96 عددی 600,000 BioBasic
224 سر سمپلر زرد (200 میکرو لیتر)مدرج استریل Rnase/DNase Free بسته هزار عددی BT224-YS بسته هزار عددی 1,950,000 BioBasic
225 رک سرسمپلرکریستالی (10-5/0 میکرو لیتر)استریل رک 96 عددی Rnase/DNase Free BT225-RS رک 96 عددی 580,000 BioBasic
226 سرسمپلرکریستالی بلند (10-5/0 میکرو لیتر)استریل بسته هزار عددی Rnase/DNase Free BT225-S 1000pcs 1,800,000 BioBasic
227 تیوب 65/0 میلی لیتر استریل ، بسته 1000 عددی Rnase/DNase Free BT613-NS 1000pcs 2,950,000 BioBasic
228 0.65ML TUBE, NATURAL,STERILE,100TUBES BT613-NS-100pcs None 350,000 BioBasic
229 تیوب 2 میلی لیتر ته مخروطی استریل  Rnase/DNase Free بسته 1000 عددی BT619-NS 1000pcs 3,950,000 BioBasic
230 2ML TUBE, NATURAL,STERILE,100TUBES BT619-NS-100pcs None 450,000 BioBasic
231 تیوب 1/5 میلی لیتر بدون رنگ دارای بسته بندی 1000تایی و استریل Rnase/DNase Free BT620-NS بسته 3,950,000 BioBasic
232 1.5ML Tube, Natural, Sterile, /Bag 100 BT620-NS-100Pak None 420,000 BioBasic
233 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G-100ul None 2,500,000 BioBasic
234 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G-200ul None 4,500,000 BioBasic
235 10-250kDa Wide Range Blue/Red/Green Three Color Prestained BZ0011G.500ul None 9,500,000 BioBasic
236 Caffeine .SIZE.25G C0150-25g None 1,500,000 BioBasic
237 Citric acid, monohydrate C2123 500gr 2,850,000 BioBasic
238 CAPS C2632 100gr 8,500,000 Sigma
239 Sodium citrate, trisodium salt, dihydrate CB0035 500gr 2,500,000 BioBasic
240 Sodium citrate, trisodium salt, dihydrate.SIZE.100G CB0035-100g None 950,000 BioBasic
241 Coomassie brilliant blue R-250    CB0037 5gr 2,500,000 BioBasic
242 Coomassie brilliant blue R-250.SIZE.1G CB0037-1G None 1,100,000 BioBasic
243 Coomassie brilliant blue G-250 CB0038-100G 100G 19,950,000 BioBasic
244 Coomassie brilliant blue G-250 CB0038-25G 25G 6,500,000 BioBasic
245 Coomassie brilliant blue G-250 CB0038-5G 5G 2,500,000 BioBasic
246 Calcium carbonate, anhydrous CB0052 500gr 2,500,000 BioBasic
247 L-Cystine CB0088-100G 100G 4,500,000 BioBasic
248 Cetyldimethylethyl ammonium bromide CB0105 100gr 4,500,000 BioBasic
249 CTAB .SIZE.25G CB0108-25G 25g 1,950,000 BioBasic
250 CHES CB0115 50gr 3,200,000 BioBasic
251 Chloramphenicol CB0118 50gr 4,950,000 BioBasic
252 Chloramphenicol CB0118 250gr 17,500,000 BioBasic
253 Chloramphenicol CB0118-10G 10G 2,500,000 BioBasic
254 Chloramphenicol CB0118-1G None 750,000 BioBasic
255 Chloramphenicol CB0118-5G None 1,500,000 BioBasic
256 L-Cysteine CB0132 100gr 3,950,000 BioBasic
257 L-Cysteine hydrochloride, monohydrate CB0133 100gr 3,300,000 BioBasic
258 L-Cysteine hydrochloride. monohydrate CB0133-500 None 14,000,000 BioBasic
259 Calcium acetate monohydrate CB0249 250gr 2,950,000 BioBasic
260 Calcium Hydroxide CB0256 500gr 3,950,000 BioBasic
261 Calcium nitrate. tetrahydrate CB0258-500g None 2,950,000 BioBasic
262 Calcium phosphate, dibasic, dihydrate CB0262 500gr 3,500,000 BioBasic
263 Calcium sulfate, dihydrate CB0265 500gr 3,950,000 BioBasic
264 Calcium sulfate, dihydrate CB0265-100g None 1,950,000 BioBasic
265 Calcium sulfate, dihydrate CB0265-50g None 1,200,000 BioBasic
266 L-Carnitine (Vitamin BT ) CB0272 25gr 3,950,000 BioBasic
267 D-(+) Cellobiose CB0278 5gr 6,500,000 BioBasic
268 4-Chloro-1-naphthol CB0293 10gr 3,950,000 BioBasic
269 Chlortetracycline, hydrochloride CB0297 25gr 4,200,000 BioBasic
270 Cholic acid CB0298-50g None 5,950,000 BioBasic
271 Choline chloride CB0299 100G 3,200,000 BioBasic
272 Ciprofloxacin hydrochloride CB0310 25g 3,850,000 BioBasic
273 Colchicine CB0322 100mg 4,950,000 BioBasic
274 Congo Red CB0324 50gr 3,500,000 BioBasic
275 Creatine hydrate CB0326 100G 2,950,000 BioBasic
276 Creatinine CB0328 5gr 1,500,000 Sigma
277 Creatinine CB0328-25G 25G 3,500,000 BioBasic
278 Crystal violet CB0331 25gr 1,950,000 BioBasic
279 CTAC , Cetyltrimethy lammonium chloride CB0332 100gr 3,950,000 BioBasic
280 CTAC, Cetyltrimethylammonium chloride CB0332-25g 25g 1,500,000 BioBasic
281 a-Cyclodextrin hydrate CB0348-5G 4,500,000 BioBasic
282 Cyclosporin A CB0352 250mg 3,950,000 BioBasic
283 STEM-CELLBANKER GMP grade-20ml CB046 20ml 4,950,000 TaKaRa
284 CELLOTION CB051  100ml 4,950,000 TaKaRa
285 Chitosan CB0660 500G 23,000,000 BioBasic
286 Chitosan CB0660 100gr 5,500,000 BioBasic
287 Chitosan .SIZE.50G CB0660-50g None 3,500,000 BioBasic
288 4-Chlorophenoxyacetic acid CB0720 100G 2,950,000 BioBasic
289 4-Chlorophenoxyacetic acid sodium salt CB0721 100G 2,950,000 BioBasic
290 Copper (II) acetate hydrate CB3050 100G 2,950,000 BioBasic
291 Casamino Acids CB3060 100gr 3,500,000 BioBasic
292 CASAMINO ACID CB3060-25g None 1,100,000 BioBasic
293 Copper (II) chloride hydrate CB3090 250G 3,600,000 BioBasic
294 Cresol red , sodium salt CD0037C 5gr 1,950,000 BioBasic
295 CHAPS CD0110 1gr 1,950,000 BioBasic
296 CHAPSO CD0113 1gr 2,950,000 BioBasic
297 Copper (II) sulfate pentahydrate CDB0063 500G 4,500,000 BioBasic
298 Copper (II) sulfate pentahydrate CDB0063-100G 100g 1,500,000 BioBasic
299 Carbenicillin disodium CDJ469-1g 1g 9,500,000 BioBasic
300 10/200mm Communis Chromatography ColUMns CH001.SIZE.1 5,400,000 BioBasic
301 10/300mm Communis Chromatography Columns CH002 10/30mm 5,950,000 BioBasic
302 10/400mm Communis Chromatography Columns CH003 10/400mm 6,950,000 BioBasic
303 10/500mm Communis Chromatography Columns CH004 10/500mm 7,500,000 BioBasic
304 16/200mm Communis Chromatography Columns CH007 16/200mm 6,950,000 BioBasic
305 16/300mm Communis Chromatography Columns CH008 16/300mm 7,950,000 BioBasic
306 CARRAGEENAN CN1138 500G 6,950,000 BioBasic
307 CARRAGEENAN CN1138-100g None 2,500,000 BioBasic
308 CARRAGEENAN CN1138-250g None 4,500,000 BioBasic
309 CARRAGEENAN CN1138-25g None 950,000 BioBasic
310 Calcium chloride, anhydrous CT1330 500G 3,600,000 BioBasic
311 Calcium chloride, anhydrous CT1330-250g None 2,200,000 BioBasic
312 Agarose A D0012-50g 50g 4,500,000 BioBasic
313 TSG DNA Polymerase, 5U/UL D0081 200u 3,500,000 BioBasic
314 Dimethyl sulfoxide (DMSO) D0231 500ml 3,950,000 BioBasic
315 Glyoxal, 40% solution D0238 1KG 4,950,000 BioBasic
316 Dialysis tubing cellulose membrane23mm غشاء دیالیز با قطر 23mm (Molecular weight cut-off : 12400Da) D0405 Meter 1,800,000 Sigma
317 Dialysis tubing cellulose membrane10mm غشاء دیالیز با قطر 10mm (Molecular weight cut-off : 14KDa) D9277 Meter 1,800,000 Sigma
318 Dialysis tubing cellulose membrane43mm غشاء دیالیز با قطر 43mm (Molecular weight cut-off : 14KDa) D9527 Meter 1,800,000 Sigma
319 2'-Deoxythymidine DB0049 1gr 1,950,000 BioBasic
320 DTT DB0058 5gr 7,950,000 BioBasic
321 DTT .SIZE.1G DB0058-1g None 3,500,000 BioBasic
322 DTNB DB0113 5gr 12,500,000 BioBasic
323 DTNB, 5,5'-Dithiobis-(2-nitrobenzoic acid) DB0113-1g None 4,500,000 BioBasic
324 DEAE, Dextran HCl-Form DB0147 10G 4,200,000 BioBasic
325 DEPC DB0154 5ml 4,500,000 BioBasic
326 DEPS DB0154-1ml None 1,950,000 BioBasic
327 2,4-Dichlorophenoxy acetic acid DB0166 100G 2,950,000 BioBasic
328 DNA & RNase Away™ DB0339 200ml 4,200,000 BioBasic
329 N-N-Dimethylglycine hydrochloride DB0412 25gr 1,950,000 BioBasic
330 DTAB,dodecyltrimethyl ammonium bromide DB0431-50G 50g 4,500,000 BioBasic
331 Doxycycline, hydrochloride DB0889-1g None 1,100,000 BioBasic
332 Doxycycline, hydrochloride DB0889-5g None 2,950,000 BioBasic
333 Diethylamine DC3320 500ML 7,950,000 BioBasic
334 dNTP mixture (10mM) DD0056 0.5ml 2,950,000 BioBasic
335 DIPSO free acid DD0166D 25G 3,300,000 BioBasic
336 2,7-Dichlorofluorescein DD1220 5G 3,950,000 BioBasic
337 Dimethylglyoxime sodium salt DD1221-100G 100g 2,950,000 BioBasic
338 Denaturing solution DE540 1L 2,950,000 BioBasic
339 Decyl-beta-D-glucopyranoside DJ574 100MG 2,950,000 BioBasic
340 DNAfectamine DNAF001-0.3ML None 16,950,000 BioBasic
341 Silica gel with moisture indicator DSG110-1KG None 3,750,000 BioBasic
342 Silica Gel Dryer DSG111-1PK None 2,950,000 BioBasic
343 Green-DNA Dye ,ready to use 0.5ml DT81414-0.5ML None 5,500,000 BioBasic
344 Eco-Red-DNA Dye . Ready to use DT81415-0.5ML None 5,500,000 BioBasic
345 Eco-Stain Plus . ready to use DT81418-1 ML 1ML 16,950,000 BioBasic
346 EDTA , free acid EB0107 500gr 3,500,000 BioBasic
347 Erythromycin EB0192 25gr 7,500,000 BioBasic
348 EDTA , Iron (III), sodium salt EB0437 100gr 3,500,000 BioBasic
349 Eosin Y, sodium salt EB0441 25G 1,950,000 BioBasic
350 Erythritol EB0444 100G 4,300,000 BioBasic
351 esculin, hydrate EB0452 5G 5,500,000 BioBasic
352 EDTA zinc (II), disodium salt EB6666 100G 3,300,000 BioBasic
353 EGTA ED0077 25g 5,950,000 BioBasic
354 Bromocresol green, sodium salt ED0087 5gr 2,950,000 BioBasic
355 Eosin Y, free acid EE0190 25gr 1,950,000 BioBasic
356 Eosin Y . free acid EE0190-100g None 4,950,000 BioBasic
357 Freund’s Adjuvant, Complete F5881 10ml 9,500,000 Sigma
358 Agar A FB0010-100G 100gr 2,500,000 BioBasic
359 Agar B FB0012 500G 9,950,000 BioBasic
360 Agar B FB0012 100gr 2,700,000 BioBasic
361 Fluorescein, disodium salt FB0203 100G 2,950,000 BioBasic
362 Formamide deionized FB0211 100ml 2,950,000 BioBasic
363 D(-)-Fructose FB0213 500gr 1,950,000 BioBasic
364 Iron(II) sulfate . heptahydrate FB0461-100g None 1,500,000 BioBasic
365 Iron(II) sulfate . heptahydrate FB0461-50g None 900,000 BioBasic
366 Fluorescein, free acid FB0463 100G 2,950,000 BioBasic
367 Folic acid (Vitamin M) FB0466 25gr 9,500,000 BioBasic
368 Folic acid (Vitamin M) FB0466-5g None 4,950,000 BioBasic
369 5-Fluorouracil FD0080 5gr 3,950,000 BioBasic
370 Fluorene FD1223 50gr 2,950,000 BioBasic
371 نوک کریستالی فیلتردارRnase & Dnase free- GEB FT0010-B-N None 3,950,000 GEB
372 رک نوک فیلتردارRnase & Dnase free 10ul-GEB FT0010-R-NS None 800,000 GEB
373 نوک زرد فیلتردار Rnase & Dnase free- GEB FT0102-B-N None 3,950,000 GEB
374 رک نوک فیلتردارRnase & Dnase free 100ul-GEB FT0102-R-NS None 800,000 GEB
375 سرسمپلر فیلتردار شفاف 10- 1/0میکرولیتر بسته 1000 عددی FT215 1000pcs 4,950,000 BioBasic
376 رک سرسمپلر فیلتردار( 1000-100میکرولیتر) استریل رک 100 عددی  Rnase/DNase Free FT222-RS رک 100 خانه 980,000 BioBasic
377 رک سر سمپلر کریستالی فیلتردار(10-5/0میکرولیتر) استریل رک 96 عددی  Rnase/DNase Free FT225-RNS رک 96 عددی 800,000 BioBasic
378 Rapid Fungal DNA Isolation Kit FT71415 50preps 5,950,000 BioBasic
379 Rapid Fungal RNA Extraction Kit FT71416 50preps 6,950,000 BioBasic
380 Glucose oxidase G0243 50KU 11,000,000 BioBasic
381 AGAR C G1253 100gr 1,950,000 BioBasic
382 Peptone E Gelatin Peptone G212 100gr 2,950,000 BioBasic
383 Peptone A From Meat G213 500G 7,950,000 BioBasic
384 Peptone A From Meat G213  100gr 1,950,000 BioBasic
385 Peptone D Protease Peptone G241 100gr 2,500,000 BioBasic
386 Peptone D Protease Peptone G241 500G 8,950,000 BioBasic
387 Agar D, Purified Agar G243 100G 5,500,000 BioBasic
388 Peptone F Lactalbumin Hydrolysate G256-100G None 2,500,000 BioBasic
389 PolyPeptone G258 100G 3,500,000 BioBasic
390 Peptone C Peptonized Milk G292 500G 5,950,000 BioBasic
391 Peptone C Peptonized Milk G292 100G 1,950,000 BioBasic
392 Glass beads G8772 10gr 4,800,000 Sigma
393 D(+)Galactose GB0215 100gr 4,950,000 BioBasic
394 Gentamycin sulfate   GB0217 1gr 1,500,000 BioBasic
395 Gentamycin sulfate GB0217 5gr 3,950,000 BioBasic
396 L-Glutamic acid GB0221 500gr 5,500,000 BioBasic
397 L-Glutamic acid GB0221-100g None 2,500,000 BioBasic
398 L-Glutamine GB0224 100gr 3,500,000 BioBasic
399 L-Glutamine GB0224-500G None 13,500,000 BioBasic
400 glycine GB0235 500 gr 4,950,000 BioBasic
401 Glycine.SIZE.100G GB0235-100G 100G 1,950,000 BioBasic
402 Guanosine-5'-triphosphate [GTP], 100 mM solution GB0332 0.25ml 4,350,000 BioBasic
403 Gallic acid GB0476 250g 5,500,000 BioBasic
404 Gallic acid GB0476-100G None 2,950,000 BioBasic
405 Giemsa stain    GB0477 10gr 2,500,000 BioBasic
406 Glucose-6-phosphate, disodium salt, hydrate GB0481-1g None 4,950,000 BioBasic
407 Guanosine GD0250 25gr 2,950,000 BioBasic
408 G 418 sulfate GDJ958 100mg 2,950,000 BioBasic
409 DNA Marker H2 50,100,150,200,250,300,400,500,600,700,800 900 GM345.SIZE.50 load None 5,950,000 BioBasic
410 HEPES, free acid HB0264 250gr 9,950,000 BioBasic
411 HEPES, free acid HB0264 50gr 3,500,000 BioBasic
412 HEPES free acid HB0264-1KG 1Kg 36,000,000 BioBasic
413 HEPES, sodium salt HB0265 50g 3,950,000 BioBasic
414 HEPES, sodium salt HB0265-250G None 11,000,000 BioBasic
415 L-Histidine, hydrochloride.SIZE.100G HB0330-100G None 3,950,000 BioBasic
416 L-Histidine, hydrochloride.SIZE.25G HB0330-25g None 1,100,000 BioBasic
417 Histamine dihydrochloride HB0501.SIZE.25G None 8,950,000 BioBasic
418 Histamine diphosphate HB0502 5gr 2,950,000 BioBasic
419 HOBT 1-Hydroxybenzotriazole monohydrate HB0511.SIZE.50G None 6,950,000 BioBasic
420 N-Hydroxysuccinimide-5G HB0526-5G None 1,500,000 BioBasic
421 8-Hydroxyquinoline (8-Quinolinol) HD0274-25g None 3,500,000 BioBasic
422 L-Histidine, monohydrochloride, monohydrate HE806 25gr 3,950,000 BioBasic
423 L-Histidine, monohydrochloride, HE806-5G None 1,400,000 BioBasic
424 ممبران استات سلولز بسته 100 عددی13 MM,0.45UM, 100/Box HP131 Pack 3,950,000 BioBasic
425 ممبران استات سلولز بسته 100 عددی 25 MM,0.45UM, 100/Box HP132 Pack 4,500,000 BioBasic
426 ممبران استات سلولز بسته 100 عددی 50 MM,0.45UM,100/Box HP133 Pack 4,950,000 BioBasic
427 TAQ DNA POLYMERASE-500U HTD0078 None 3,950,000 BioBasic
428 Taq DNA Polymerase (High PURITY), 5U/UL HTD0078 200u 1,950,000 BioBasic
429 Taq DNA Polymerase (High PURITY), 5U/UL HTD0078 1000U 6,500,000 BioBasic
430 4-Isothiocyanatophenyl α-D-Mannopyranoside I905135 95,000,000 TRC
431 رک 38 خانه میکروتیوب 1/5 سرماساز IB002A رک 38 عددی 1,950,000 BioBasic
432 IPTG IB0168 1gr 2,950,000 BioBasic
433 IPTG IB0168 5gr 9,950,000 BioBasic
434 INT dye IB0280 250mg 2,950,000 BioBasic
435 Indigo carmine  IB0532 10gr 1,950,000 BioBasic
436 D-myo-Inositol IB0536 100gr 3,950,000 BioBasic
437 Iodine IB0538 100gr 5,950,000 BioBasic
438 3-Indoleacetic acid (IAA) IB0723 25gr 3,950,000 BioBasic
439 3-Indole-acetic acid sodium salt IB0724 25gr 13,500,000 BioBasic
440 L-Isoleucine IB0914 50G 3,950,000 BioBasic
441 L-Isoleucine IB0914-250G 250g 12,500,000 BioBasic
442 Kanamycin sulfate KB0286 5g 2,950,000 BioBasic
443 Kanamycin sulfate KB0286 100G 29,500,000 BioBasic
444 Kanamycin sulfate.SIZE.25G KB0286-25G 25gr 8,500,000 BioBasic
445 Kinetin KB0745 25gr 5,500,000 BioBasic
446 Kinetin KB0745 100G 19,500,000 BioBasic
447 2-Ketoglutaric acid KD0290 100gr 4,500,000 BioBasic
448 Lysostaphin  from  Staphylococcus  staphyloly L7386-1MG 1mg 16,950,000 Sigma
449 Lincomycin hydrochloride LB0604-25G 25G 4,500,000 BioBasic
450 D-Lactose, monohydrate LC4280 500gr 4,950,000 BioBasic
451 Lysozyme .SIZE.5G LDB0308 7,950,000 BioBasic
452 Lysozyme LDB0308 1gr 2,950,000 BioBasic
453 Lysozyme LDB0308-25G 25G 34,000,000 BioBasic
454 Lysozyme 600mg LDB0308-600mg 600mg 2,100,000 BioBasic
455 500bp-10kb Ladder ready to use.SIZE.100 loading M101R-1-100 loading None 6,950,000 BioBasic
456 Lamda DNA / HindIII Marker, Ready to use7 DNA fragments : 23130*, 9416, 6557, 4361*, 2322, 2027 & 564 M104R-1 100 loading 3,500,000 BioBasic
457 100+50bpDNA Marker,Ready-to-use:11 DNA fragments:150,250,350,450,550,650,750,850,1000,1500bp M109-A 100 Loading 6,950,000 BioBasic
458 F8 monoclonal antibody, clone 101 MAB4180 100 ug 39,500,000 Abnova
459 Magnesium acetate, tetrahydrate MB0326 500gr 2,950,000 BioBasic
460 Magnesium chloride, hexahydrate.SIZE.100G MB0328-100G 100G 1,100,000 BioBasic
461 Manganese chloride, tetrahydrate MB0331 1KG 4,800,000 BioBasic
462 DL-Malic acid MB0333 250gr 1,500,000 BioBasic
463 Manganese sulfate, monohydrate MB0334 500G 3,600,000 BioBasic
464 D-Mannitol MB0335 100gr 1,950,000 BioBasic
465 MES, free acid, monohydrate MB0341 25gr 3,500,000 BioBasic
466 MES, free acid, monohydrate MB0341-5G 5G 1,500,000 BioBasic
467 Methylene blue, chloride, trihydrate.SIZE.50G MB0342 None 2,500,000 BioBasic
468 L-Methionine MB0346 25gr 3,950,000 BioBasic
469 Molybdic acid, sodium salt MB0358 50gr 2,950,000 BioBasic
470 D-Mannose MB0554 100G 12,000,000 BioBasic
471 Manganese acetate, tetrahydrate MB0600 250G 2,300,000 BioBasic
472 Menthol MB0608 50gr 3,200,000 BioBasic
473 Methylamine hydrochloride MB0613 100G 3,200,000 BioBasic
474 Methyl blue, sodium salt MB0614 50g 2,500,000 BioBasic
475 Methyl red  MB0627 25gr 2,500,000 BioBasic
476 Methyl red sodium salt MB0628 25G 2,950,000 BioBasic
477 Mycophenolic acid MB0640 1gr 3,950,000 BioBasic
478 MU-Gal MB1136 250mg 4,500,000 BioBasic
479 MgCl2 1.5ml MB1193-1.5ml 1.5ml 950,000 BioBasic
480 MUG MB2251-250MG 250mg 4,200,000 BioBasic
481 Malachite green oxalate MD0330 50G 1,950,000 BioBasic
482 Mucic acid MD1225 50gr 3,950,000 BioBasic
483 MOPSO, sodium salt MDB0095 25gr 2,950,000 BioBasic
484 MOPS, sodium salt MDB360S-5g None 1,500,000 BioBasic
485 Malt Extract MJ873(G257) 100gr 2,500,000 BioBasic
486 Magnesium sulfate, heptahydrate, biotech MRB0329 500gr 2,950,000 BioBasic
487 NADP N0760 250MG 6,950,000 BioBasic
488 L-Norleucine N2857 5G 5,950,000 BioBasic
489 L-Norvaline N4058 5G 1,950,000 BioBasic
490 Neomycin sulfate NB0366 25gr 4,950,000 BioBasic
491 Neomycin sulfate NB0366-5g None 1,950,000 BioBasic
492 Ninhydrin NB0378-1g None 950,000 BioBasic
493 Ninhydrin NB0378-5g None 1,950,000 BioBasic
494 Nystatin NB0390 5gr 3,950,000 BioBasic
495 Nystatin-1g NB0390-1g None 1,500,000 BioBasic
496 NAD-Trihydrate NB0641 1gr 3,500,000 BioBasic
497 NADH disodium salt, trihydrate, Reduced NB0642 1gr 6,500,000 BioBasic
498 Neutral red NB0652 25gr 3,950,000 BioBasic
499 Neutral red NB0652-5g None 1,500,000 BioBasic
500 Nicotinamide NB0659 250gr 4,200,000 BioBasic
501 Nicotinic acid (NIACIN) NB0660 250gr 4,200,000 BioBasic
502 NON-Fat Powdered Milk NB0669 250g 4,500,000 BioBasic
503 β-Naphthoxyacetic acid NB0731 100gr 2,950,000 BioBasic
504 Nalidixic acid ND0363 25g 3,950,000 BioBasic
505 Nalidixic acid .SIZE.1G ND0363-1g None 950,000 BioBasic
506 Nalidixic acid .SIZE.5G ND0363-5g None 1,950,000 BioBasic
507 1-Nitro-2-naphthol-3,6 ND1226 25G 2,950,000 BioBasic
508 Nitrotetrazolium blue chloride (NBT) NDB0379 250mg 3,500,000 BioBasic
509 Nitrotetrazolium blue chloride (NBT) NDB0379 1gr 11,000,000 BioBasic
510 Nitrotetrazolium blue chloride (NBT).SIZE.800MG NDB0379-800mg None 9,500,000 BioBasic
511 Orange II O14Z25 25gr 1,950,000 BioBasic
512 Protein Standard 2mg/ml, Ovalbumin O715080 2ml 1,800,000 BioBasic
513 Ofloxacin OB0673-25G 25G 3,500,000 BioBasic
514 Orange G, sodium salt OB0674 25gr 2,950,000 BioBasic
515 Oxacillin, sodium salt OB0677-25G 25G 12,000,000 BioBasic
516 Oligo dT cellulose OB1142 100mg 3,950,000 BioBasic
517 L-Ornithine, monohydrochloride OB7771 25gr 2,950,000 BioBasic
518 Oil Red O OD0395 50g 3,500,000 BioBasic
519 Oxalic acid. dihydrate OD0400-250g None 2,500,000 BioBasic
520 Pyronin B P0724 5gr 4,350,000 BioBasic
521 pH Standard solution pH11.0 P2311 100ml 3,300,000 BioBasic
522 Polygalacturonic acid 85% 25gr Sigma P3889-25g None 17,500,000 Sigma
523 Polygalacturonic acid 85% 5gr Sigma P3889-5g None 4,500,000 Sigma
524 Trypsin (Bovine), Modified, Sequencing Grade P5320 4*25ug 12,500,000 Abnova
525 Penicillin G, sodium salt PB0135 100gr 9,500,000 BioBasic
526 Penicillin G, sodium salt PB0135 25gr 3,950,000 BioBasic
527 Penicillin G, sodium salt.SIZE.5G PB0135-5g None 1,950,000 BioBasic
528 Pepsin 1: 3000 PB0411-25g None 3,500,000 BioBasic
529 Phenol red PB0420 25gr 4,500,000 BioBasic
530 Phenol red PB0420-5G 5g 1,500,000 BioBasic
531 L-Phenylalanine.SIZE.50G PB0422-50gr 50g 2,950,000 BioBasic
532 PEG 4000 PB0431 500gr 3,500,000 BioBasic
533 PEG4000.SIZE.100G PB0431-100g None 1,100,000 BioBasic
534 PEG 6000 PB0432 500gr 3,500,000 BioBasic
535 Ponceau S PB0437 25gr 2,950,000 BioBasic
536 Potassium acetate PB0438 500gr 3,850,000 BioBasic
537 Potassium carbonate, anhydrate PB0439 500G 3,600,000 BioBasic
538 Potassium chloride PB0440 500gr 3,200,000 BioBasic
539 Potassium chloride PB0440-100G 100G 1,100,000 BioBasic
540 Potassium iodide   PB0443 50gr 2,950,000 BioBasic
541 Potassium phosphate, monobasic, anhydrous PB0445 500gr 3,950,000 BioBasic
542 Potassium Phosphat,Monobasic -100G PB0445-100G 100G 1,200,000 BioBasic
543 Potassium Phosphat,Monobasic -50G PB0445-50g None 850,000 BioBasic
544 Potassium sorbate PB0446 100gr 1,500,000 BioBasic
545 Potassium phosphate, dibasic, anhydrous PB0447 500gr 3,950,000 BioBasic
546 Proteinase K PB0451 50mg 4,950,000 BioBasic
547 Pancreatin-8.0 PB0681-100G 100g 5,950,000 BioBasic
548 D-Pantothenic acid hemicalcium salt (Vitamin B5) PB0683 100gr 3,950,000 BioBasic
549 Pluronic F-127 PB0750 100G 9,750,000 BioBasic
550 Potassium sulfate, anhydrous PB0782 500G 4,300,000 BioBasic
551 Protein A PB0789 10mg 5,500,000 BioBasic
552 L-Proline PB0923-100G 100gr 3,600,000 BioBasic
553 POPSO, disodium salt PB4959 25G 5,400,000 BioBasic
554 POPSO, free acid PB4979 25G 3,500,000 BioBasic
555 Potassium sulfite PB6688 500gr 4,300,000 BioBasic
556 Paraffin oil (Mineral oil), extra heavy PC5532-50ml None 1,100,000 BioBasic
557 Pyrogallol ( 1,2,3-Trihydroxybenzene) PC6880 100gr 8,500,000 BioBasic
558 10x Taq Buffer (MgCl2)1.5ml PCRB16-1.5ml 950,000 BioBasic
559 10x Taq Buffer (NH4)2SO4.SIZE.1.5ml PCRB55-1.5ML 950,000 BioBasic
560 10x Taq Buffer.SIZE.1.5ml PCRB60-1.5ml 1.5ml 950,000 BioBasic
561 Phenol red, sodium salt PD0424 25gr 3,200,000 BioBasic
562 PBS PD0435 1 tablet 85,000 BioBasic
563 Potassium ferricyanide PD0442 100gr 2,950,000 BioBasic
564 Propylene glycol ( 1,2-Propanediol) PD0450 500ml 1,950,000 BioBasic
565 Phosphotungstic acid hydrate PD1241 25gr 3,950,000 BioBasic
566 PIPES, sodium salt PDB0434 100G 7,800,000 BioBasic
567 Phosphatase Inhibitor Cocktail II PL019-1ml None 2,950,000 BioBasic
568 Proflavine hydrochloride PN1227 25G 5,950,000 BioBasic
569 Blotting Paper, 10x15cm, 100 SHEETS PP3322 None 9,500,000 BioBasic
570 Blotting Paper, 15x15cm, 100 SHEETS PP3323 None 9,950,000 BioBasic
571 Gel Blot Paper . 20x20 cm PP3324-1PK None 12,000,000 BioBasic
572 Potassium acetate.SIZE.500G PRB0438 3,950,000 BioBasic
573 Potassium bromide PT0762 500G 4,650,000 BioBasic
574 Potassium oxalate, monohydrate PT0774 500G 5,850,000 BioBasic
575 Potassium bicarbonate PT1195 500G 2,300,000 BioBasic
576 Rapid Plant RNA Isolation Kit PT4191 50preps 6,950,000 BioBasic
577 Quinine hemisulfate salt monohydrate QB0802 25G 4,500,000 BioBasic
578 Quinine sulfate, dihydrate QB0803 25G 3,300,000 BioBasic
579 Yeast Extract Qlab 500gr QB-39-5701 None 6,500,000 Qlab
580 Green-2-Go 2X qPCR-S Mastermix QPCR004-S-1.25ML None 6,950,000 BioBasic
581 Green-2-Go TaqProbe qPCR Mastermix-no Dye ) QPCR005-NODYE.1.25ML None 6,950,000 BioBasic
582 Hs-ALPL-1-SG QuantiTect primer assay QT00012957 Pack 12,000,000 Qiagen
583 Hs-SPARC-1-SG QuantiTect primer assay QT00018620 Pack 12,000,000 Qiagen
584 Hs-RB1-1-SG QuantiTect primer assay QT00066899 Pack 12,000,000 Qiagen
585 Hs-BGLAP-1-SG QuantiTect primer assay QT00232771 Pack 12,000,000 Qiagen
586 Hs-SPP1-1-SG QuantiTect primer assay QT01008798 Pack 12,000,000 Qiagen
587 Taq DNA polymerase 50 unit R001Q None 3,950,000 TaKaRa
588 جعبه 5 خانه مخصوص تیوب سانتریفیوژ(تیوب 5/1 یا 2 میلی لیتر) R005-G Pack 400,000 BioBasic
589 جعبه 5 خانه مخصوص تیوب سانتریفیوژ (ویال شیشه ای 3 میلی لیتر) R006-G Pack 400,000 BioBasic
590 جعبه 5 خانه مخصوص تیوب سانتریفیوژ (ویال شیشه ای 10 میلی لیتر) R007-G Pack 400,000 BioBasic
591 TaKaRa Taq Hot Start 50 units R007Q None 4,950,000 TaKaRa
592 Rosaniline chloride R2770 25gr 2,500,000 BioBasic
593 کاور مخصوص رک 80 خانه دورو  بدون رنگ R567-C Pack 450,000 BioBasic
594 کاور مخصوص رک 96 خانه دورو  بدون رنگ R577-C Pack 450,000 BioBasic
595 رک میکروتیوب0.2درب لولایی رک153خانه- Globall Roll Rack0.2 None 300,000 Global Roll
596 رک میکروتیوب0.5درب لولایی رک98خانه- Globall Roll Rack0.5 None 300,000 Global Roll
597 رک میکروتیوب1.5درب لولایی رک72خانه- Globall Roll Rack1.5 None 300,000 Global Roll
598 Rhodamine B RB0464 100gr 3,950,000 BioBasic
599 RNase A RB0473 25mg 2,950,000 BioBasic
600 Rubidium chloride RB0668 25gr 16,500,000 BioBasic
601 Ribostamycin sulfate salt RB0807 5gr 3,200,000 BioBasic
602 Rifampicin RB0808 25g 8,950,000 BioBasic
603 Rifampicin RB0808-5G None 2,500,000 BioBasic
604 Rose Bengal, sodium salt RB0809 50gr 9,500,000 BioBasic
605 Rose Bengal, sodium salt RB0809-10G 10G 2,950,000 BioBasic
606 Rose Bengal, sodium salt RB0809-25gr 25gr 5,500,000 BioBasic
607 Rose Bengal, sodium sal RB0809-5G None 1,650,000 BioBasic
608 2 x RIPA Buffer I ( pH 7.4) 2 x concentrate RB4475 500ml 3,950,000 BioBasic
609 2 x RIPA Buffer II (Ph8.0)2x concentrate RB4476 500ml 3,950,000 BioBasic
610 Recombinant Vascular Endothelial Growth Factor165 RC216-16.SIZE.2UG None 9,750,000 BioBasic
611 Riboflavin 25g RD0470-25g None 1,950,000 BioBasic
612 D-Ribose RD0475 25gr 2,500,000 BioBasic
613 Sodium sulfate, anhydrate RD0489 2.5KG 8,550,000 BioBasic
614 Sodium sulfate, anhydrate RD0489-500G 500G 2,500,000 BioBasic
615 Raffinose, pentahydrate RJ392 25gr 5,500,000 BioBasic
616 TaKaRa EX Taq Hot Start 250 units RR006A None 22,000,000 TaKaRa
617 TaKaRa EX Taq Hot Start 50 units RR006Q None 5,950,000 TaKaRa
618 TaKaRa EX Taq Hot Start 20 units RR006Q-20U None 2,950,000 TaKaRa
619 Real Time one step RNA PCR kit, Version 2 RR026 100 Test 22,000,000 TaKaRa
620 TaKaRa LA Taq HS (dNTP inclus) RR042Q None 7,500,000 TaKaRa
621 SpeedSTAR™ HS DNA Polymerase RR070Q 50 Units 3,950,000 TaKaRa
622 سل شیشه ای با درب حجم 1.7 میلی لیتر به ابعاد45*12.5*7.5 میلیمتر S003-G Pack 1,500,000 BioBasic
623 سل شیشه ای با درب به ابعاد 45*12.5*12.5 میلیمتر با حجم 3.5 میلی متر S004-G Pack 1,500,000 BioBasic
624 Sodium thioglycolate S0265 25G 1,800,000 BioBasic
625 Sodium thioglycolate S0265-50g None 3,300,000 BioBasic
626 Sodium phosphate, dibasic, anhydrous.SIZE.100G S0404-100g None 1,500,000 BioBasic
627 Sudan black B S0593 5gr 1,500,000 BioBasic
628 Spermidine trihydrochloride S714272 5,500,000 BioBasic
629 Sodium sulfate, anhydrate SB0298 500G 1,800,000 BioBasic
630 Sodium chloride SB0476 1kg 1,950,000 BioBasic
631 Sodium chloride.SIZE.100g SB0476-100g None 550,000 BioBasic
632 Sodium chloride.SIZE.250G SB0476-250g None 900,000 BioBasic
633 Sodium chloride.SIZE.5KG SB0476-5KG 5kg 7,950,000 BioBasic
634 Sodium acetate, trihydrate SB0481 500g 1,950,000 BioBasic
635 Sodium bicarbonate SB0482 500g 1,800,000 BioBasic
636 Sodium acetate 3M solution SB0483 500ml 1,500,000 BioBasic
637 D-Sorbitol .SIZE.100G SB0491-100g None 850,000 BioBasic
638 Streptomycin sulfate SB0494 50gr 3,950,000 BioBasic
639 Streptomycin sulfate .SIZE.10G SB0494-10g None 1,500,000 BioBasic
640 Sucrose SB0498 500gr 1,800,000 BioBasic
641 Sucrose SB0498-2.5KG None 6,950,000 BioBasic
642 5-Sulfosalicylic acid, dihydrate SB0610 50gr 1,600,000 BioBasic
643 5-Sulfosalicylic acid, dihydrate SB0610 250gr 5,950,000 BioBasic
644 Sodium oxalate SB0829 500G 9,500,000 BioBasic
645 Sodium oxalate-250g SB0829-250g None 5,950,000 BioBasic
646 Sodium L-ascorbate SB0830 100gr 2,500,000 BioBasic
647 Sodium benzoate SB0833 500gr 3,950,000 BioBasic
648 Sodium bisulfite SB0834 500gr 2,950,000 BioBasic
649 Sodium bromide SB0837 250gr 2,950,000 BioBasic
650 Sodium butyrate SB0838 5gr 2,500,000 BioBasic
651 Sodium cholate, hydrate SB0841 25gr 3,950,000 BioBasic
652 Cromolyn sodium salt SB0843 5G 3,300,000 BioBasic
653 Sodium diphenylamine-4-sulfonate SB0847-10g None 9,500,000 BioBasic
654 Sodium diphenylamine-4-sulfonate SB0847-25g None 19,500,000 BioBasic
655 Sodium diphenylamine-4-sulfonate SB0847-5g None 4,950,000 BioBasic
656 Sodium metabisulfite SB0862 500gr 2,500,000 BioBasic
657 Sodium periodate SB0875 25gr 2,500,000 BioBasic
658 Sodium phosphate, monobasic, anhydrous SB0878 500gr 3,950,000 BioBasic
659 Sodium phosphate, monobasic, dihydrate SB0879 500gr 3,500,000 BioBasic
660 Sodium pyruvate SB0884 100gr 4,500,000 BioBasic
661 Sodium pyruvate SB0884 10gr 1,500,000 BioBasic
662 Sodium salicylate SB0885 250G 2,700,000 BioBasic
663 Sodium succinate, dibasic, hexahydrate SB0889 500G 6,300,000 BioBasic
664 Sodium Thiocyanate SB0897 250gr 2,950,000 BioBasic
665 Sorbic acid SB0899 500G 4,500,000 BioBasic
666 Spermine tetrahydrochloride SB0902 1gr 5,850,000 BioBasic
667 Starch soluble SB0904 500gr 3,750,000 BioBasic
668 Sudan IV (sudan Red 4) SB0914 25G 1,950,000 BioBasic
669 Sulfur sublimed SB0917 250gr 2,500,000 BioBasic
670 L-Serine SB1479 25gr 3,500,000 BioBasic
671 L-Serine SB1479-10G 10g 1,950,000 BioBasic
672 L-Serine SB1479-5G 5g 1,100,000 BioBasic
673 Sodium acetate, anhydrate SB1611 500gr 3,200,000 BioBasic
674 Saponin SB4521 25gr 2,600,000 BioBasic
675 Sodium Bismuthate SB7820 25gr 5,700,000 BioBasic
676 Sodium bisulfate, monohydrate SB7834 500G 2,950,000 BioBasic
677 Succinic anhydride SB7835-250g None 2,950,000 BioBasic
678 Sodium phosphate, tribasic, dodecahydrate SC8240-500g None 3,950,000 BioBasic
679 فلاسک کشت سلول75cmفیلتردار استریل-Sorfa SCF12250 None 950,000 Sorfa
680 Sodium thiosulfate, pentahydrate SD0256 500gr 3,500,000 BioBasic
681 Sodium thiosulfate, pentahydrate SD0256-100g None 1,100,000 BioBasic
682 Sodium borate, decahydrate SD0480-100g None 1,100,000 BioBasic
683 Succinic acid SD0496 500gr 4,500,000 BioBasic
684 Succinic acid SD0496-100g None 2,100,000 BioBasic
685 پلیت DNA 96 خانه با غشاء(960 میکرو مول) SD5007 plate 2,100,000 BioBasic
686 LB Agar Broth SD7003(S519) 250gr 3,950,000 BioBasic
687 LB AGAR BROTH SD7003(S519)-100g None 2,500,000 BioBasic
688 LB AGAR BROTH SD7003(S519)-50g None 1,500,000 BioBasic
689 LB-Top Agar SD7004-250g None 3,950,000 BioBasic
690 LB Lennox Agar SD7006-250g None 3,950,000 BioBasic
691 SOB BROTH.SIZE.250G SD7007 None 3,950,000 BioBasic
692 Sob Agar SD7008 250gr 3,950,000 BioBasic
693 NZCYM Broth SD7010 100G 2,600,000 BioBasic
694 NZCYM Agar SD7011 100G 2,600,000 BioBasic
695 NZYM Broth SD7012 100G 2,300,000 BioBasic
696 NZYM Agar SD7013 100G 2,600,000 BioBasic
697 NZM Broth SD7014 100G 2,300,000 BioBasic
698 NZM Agar SD7015 100G 2,600,000 BioBasic
699 YT Broth SD7016-250g None 3,950,000 BioBasic
700 YT Agar SD7017-250g None 4,500,000 BioBasic
701 2x YT Agar SD7020-250g None 3,950,000 BioBasic
702 2x YT Top Agar SD7021-250g None 3,950,000 BioBasic
703 YPD Broth SD7022-250g None 3,950,000 BioBasic
704 YPD Agar SD7023-250g None 3,950,000 BioBasic
705 M9 Medium SD7024 250G 3,950,000 BioBasic
706 YM Medium SD7031 250G 3,950,000 BioBasic
707 YM Agar SD7034 250G 4,950,000 BioBasic
708 TERRIFIC BROTH.SIZE.250G SD7035(DJ980) None 3,950,000 BioBasic
709 EDTA 0.5M sterile solution SD8135 450ml 3,950,000 BioBasic
710 Sodium lauroyl sarcosine SDB0486-50g None 1,950,000 BioBasic
711 Sodium phosphate, dibasic, heptahydrate.SIZE.100G SDB0487-100G 100G 1,100,000 BioBasic
712 Sodium carbonate, anhydrous SDB0615 500g 2,500,000 BioBasic
713 Sodium carbonate,anhydrous 2.5kg SDB0615 8,950,000 BioBasic
714 Sodium carbonate, anhydrous.SIZE.100G SDB0615-100g None 950,000 BioBasic
715 Sudan Red 7 B SJ227 10gr 3,300,000 BioBasic
716 Sulfobetaine 8 SJ547 1gr 2,950,000 BioBasic
717 Sulfobetaine 10 SJ548 1gr 3,200,000 BioBasic
718 Sulfobetaine 12 SJ550 1gr 3,200,000 BioBasic
719 EZ-10 Spin Column Blood Genomic DNA MiniPreps Kit SK8253 50preps 7,500,000 BioBasic
720 EZ-10 Spin Column Plant Genomic DNA Mini-Preps Kit SK8262 100 PREPS 13,950,000 BioBasic
721 SanPrep Column microRNA Mini-Preps Kit SK8811 50PRES 11,000,000 BioBasic
722 High purity PCR Master Mix SP001-40-1ml None 900,000 Aminsan
723 سل کوارتز UV استاندارد با درب تفلونی دو طرف مات با ابعاد 45*12.5*12.5 و حجم 3.5 میلی لیتر SQ014 Pack 13,500,000 BioBasic
724 سل کوارتز با درب ساده 4 طرف مات به ابعاد 45*12.5*12.5 میلیمتر با حجم 0.7 میلی لیتر UV میکرو SQ244 عدد 7,500,000 BioBasic
725 سل کوارتز با درب تفلونی 4 طرف مات به ابعاد 45*12.5*12.5 میلیمتر و حجم 1.4 میلی لیتر UV سمی میکرو SQ294 عدد 11,000,000 BioBasic
726 Sodium acetate SRB1611 500gr 3,500,000 BioBasic
727 GDF9 human 20ug Sigma SRP4872 None 55,000,000 Sigma
728 Thiazoyl blue tetrazolium bromide (MTT) T0793-500mg 500mg 4,950,000 BioBasic
729 Retro Nectin Dish 1 plate T110A None 4,950,000 TaKaRa
730 Tris-(hydroxymethyl) propane T1491-100g None 4,950,000 BioBasic
731 TNBT (Titanium(IV) butoxide) T6756 250MG 6,950,000 BioBasic
732 Western BLoT Immuno Booster Sample T7111Q 20ml 1,950,000 TaKaRa
733 Western BLoT Rapid Detect Sample T7121Q 2test 2,950,000 TaKaRa
734 Trimethoprim T714206 5g 6,500,000 BioBasic
735 Trimethoprim T714206-1G None 2,950,000 BioBasic
736 One-Tube Swab DNA Extraction Kit T71612 20preps 3,950,000 BioBasic
737 PBS T900 1Tablets 95,000 TaKaRa
738 Tris-Glycine-SDS powder T901 Pack 550,000 TaKaRa
739 Tris Glycin powder T902 Pack 450,000 TaKaRa
740 L-broth powder T904 Pack 550,000 TaKaRa
741 TES, sodium salt TB0124 25G 3,600,000 BioBasic
742 Tris  TB0194 500gr 5,500,000 BioBasic
743 Tris  TB0194 2.5kg 25,500,000 BioBasic
744 Tris TB0194-100g None 1,950,000 BioBasic
745 Tris TB0194-50g None 1,100,000 BioBasic
746 Triton X-100 TB0198 500ml 2,500,000 BioBasic
747 TMB dihydrochloride TB0514 1gr 4,500,000 BioBasic
748 TMB dihydrochloride.SIZE.5G TB0514 None 17,500,000 BioBasic
749 Polyoxyethylene-20 (TWEEN 20) TB0560 500ml 2,950,000 BioBasic
750 2,3,5-Triiodobenzoic acid TB0735 5gr 2,950,000 BioBasic
751 L-Threonine TB0919 100gr 4,500,000 BioBasic
752 TAPS, sodium salt TB0920 50G 4,500,000 BioBasic
753 L-Tartaric acid TB0925 500G 7,950,000 BioBasic
754 Taurine TB0926 100gr 3,950,000 BioBasic
755 TES, free acid TB0927 50G 5,400,000 BioBasic
756 Thymine TB0943-100g None 7,500,000 BioBasic
757 Thymol blue, free acid TB0944 25G 5,950,000 BioBasic
758 Thymolphthalein TB0945 25G 4,800,000 BioBasic
759 Thymol TB0946 25gr 3,300,000 BioBasic
760 Tiron TB0951 25G 4,950,000 BioBasic
761 Toluidine Blue O TB0962 5G 2,950,000 BioBasic
762 L-Tryptophan TB1911-1g None 850,000 BioBasic
763 L-Tryptophan TB1911-5g None 1,750,000 BioBasic
764 L-Tryptophan TB1911-800mg None 750,000 BioBasic
765 L-Tyrosine TB1932-5G None 950,000 BioBasic
766 TAPS, free acid TB3566 50G 2,950,000 BioBasic
767 1.5ML CONICAL TUBE WITH SCREWCAP, AMBER,500/BAG TC157-A 500/BAG 4,950,000 BioBasic
768 Tris acetate TD0101-25gr 25gr 1,600,000 BioBasic
769 Culture Tube, 12 ml, Natural, Dual Cap, Sterile TD444-S.SIZE.1PK None 1,800,000 BioBasic
770 Triton X-114.SIZE.500ML TDB0554 500ml 3,200,000 BioBasic
771 1.5ML SKIRTED TUBE WITH SCREWCAP, STERILE, NATURAL,500/BAG TK352-SN None 4,950,000 BioBasic
772 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, BLUE,500/BAG TK353-SB None 4,950,000 BioBasic
773 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, RED,500/BAG TK354-SR None 4,950,000 BioBasic
774 1.5ML Skirted Tube With Screw Cap, Amber, 500/Bag TK357-A بسته 6,950,000 BioBasic
775 1.5ML SKIRTED TUBE WITH SCREW CAP, STERILE, GREEN,500/BAG TK357-SG None 4,950,000 BioBasic
776 Thymol blue, sodium salt TN1195 25G 6,950,000 BioBasic
777 Triton X-405 TS4449 100ML 4,500,000 BioBasic
778 غلطک پلیت با دسته چوبی TSM113 Pack 1,400,000 BioBasic
779 Uracil UD0564 100gr 3,500,000 BioBasic
780 Uridine UD0570 25gr 8,500,000 BioBasic
781 Uridine UD0570-5g None 3,950,000 BioBasic
782 L-Valine VB0172 500G 21,000,000 BioBasic
783 L-Valine 100G VB0172-100G 100G 4,950,000 BioBasic
784 L-Valine 250G VB0172-250G 250G 13,500,000 BioBasic
785 Vancomycin hydrochloride VB0983 1g 7,500,000 BioBasic
786 Victoria blue B VB0985 25gr 2,950,000 BioBasic
787 Rapid Viral RNA Extraction Kit VT4184 50preps 16,500,000 BioBasic
788 water nuclease free PCR grade-1.25ML WA001-0125 None 180,000 Aminsan
789 Wright's stain (Eosin methyl blue) WB0989 25gr 5,500,000 BioBasic
790 Xylene cyanol FF XB0005-5G 5G 2,500,000 BioBasic
791 Xylenol orange XB0996 10G 6,950,000 BioBasic
792 Xylitol XB0997 100gr 2,500,000 BioBasic
793 بطری پلاستیکی برای شستشو/درب آبی-قابل اتوکلاو(پی ست) XP001 Pack 550,000 BioBasic
794 Zymosan A ZB4250 100 mg 5,950,000 BioBasic

محصولات ناموجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 فلاسک کشت سلول 12.5cm سادهbiofil کانادا 10 pcs ناموجود Jetbiofil
2 پليت 6 خانه کشت سلول استريل plate ناموجود None
3 Prime STAR (high fidelity PCR) 50 u None ناموجود TaKaRa
4 Buffer Z None ناموجود TaKaRa
5 فلاسک T75 بسته 5عددي فيلتر دار Biofil کانادا 5 pcs ناموجود Jetbiofil
6 پليت ته صاف 96 خانه استريل ST plate ناموجود None
7 Chloroform 1lit ناموجود Merck
8 سمپلر متغيير 500 الي 5000 Unit ناموجود None
9 رک کرايوتيوب 1.8 Pack ناموجود چینی
10 سرسمپلر آبي Dnase Rnase Free None ناموجود None
11 بشر1000 سي سي None ناموجود None
12 لوله فالکون 15 بسته 25عددي استريل Biofil 25 pcs ناموجود Jetbiofil
13 پنبه غیر استریل بسته ناموجود ایرانی
14 سنتز پرايمر Page 100nmol None ناموجود BioBasic
15 Buffer Taq*10 None ناموجود TaKaRa
16 بنزن-امينسان None ناموجود ایرانی
17 بشر 600 سي سي None ناموجود None
18 فلاسک T25 بسته 10 عددي فيلتر دار Biofil کانادا 10 pcs ناموجود Jetbiofil
19 Buffer MgSo4 None ناموجود TaKaRa
20 tris ايراني None ناموجود ایرانی
21 perl ناموجود None
22 استريپ 0.2 (8تايي) None ناموجود چینی
23 صفحه مخصوص لام ناموجود None
24 آب اکسیژنه 2.5lit ناموجود Merck
25 پي پت پاستور شيشه اي بلند 250عددي None ناموجود None
26 ترازو دوکفه اي 200گرم None ناموجود None
27 گلايسين 50gr ايراني ناموجود ایرانی
28 Iso Propanol 2.5lit ناموجود Applichem
29 Bis Acrylamid 25g ناموجود Acros
30 پليت 48 خانه استريل plate ناموجود None
31 Acrylamide 100g ناموجود Acros
32 DMSO 2.5 lit Applichem None ناموجود Applichem
33 Sodium Hydroxide 1KG ناموجود Merck
34 TSH 96 Test Elisa Aminsan None ناموجود None
35 ايميدازول 100gr Acros None ناموجود Acros
36 Sodium Chloride 5KG ناموجود Acros
37 کلريد سديم-امينسان ناموجود ایرانی
38 Loading buffer-ايراني - None ناموجود ایرانی
39 Agarose-100gr-Acros - None ناموجود Acros
40 لوپ - pack ناموجود BioBasic
41 Greline (Rat. Mouse) 031-31 None ناموجود DUMMY
42 DNase I Solution (1 mg/mL) 0-7900 1ml ناموجود StemCell
43 Buffer Triton X100 1000 1ml ناموجود TaKaRa
44 Buffer L 1000 1ml ناموجود TaKaRa
45 Buffer K 1000 1ml ناموجود TaKaRa
46 Buffer PCR 1000 1ml ناموجود TaKaRa
47 Buffer H 1000 Vial ناموجود TaKaRa
48 Buffer M 1000 1ml ناموجود TaKaRa
49 Acetonitrile 100030 2/5L ناموجود Merck
50 Rolipram 10MG 10011132-10mg None ناموجود Cayman
51 Acc I 1001A 100U ناموجود TaKaRa
52 Recombinant Human VEGF 121. 50UG 100-20A None ناموجود DUMMY
53 Zirconium chloride 10026-11-6 25 GR ناموجود Acros
54 Acc II 1002A 100 unit ناموجود None
55 Hcl Merck 2.5 lit 100317 None ناموجود Merck
56 Phosphoric acid-Merck-2.5Lit 100573-2.5Lit None ناموجود DUMMY
57 Ethanol 100971 2.5lit ناموجود Merck
58 Ethanol 2.5lit Merck 100983 ناموجود Merck
59 BamH I 1010A 10000 U ناموجود TaKaRa
60 Ammonium persulfate [APS] 101200 1KG ناموجود Merck
61 Ban II 1012A 2000u ناموجود TaKaRa
62 Bcn I (Cau II ‘NCi1) 1019A 1,000 U ناموجود TaKaRa
63 Bgl II 1021A 2000 ناموجود TaKaRa
64 Bln I (Avr II) 1022A 400 Units ناموجود TaKaRa
65 Calcium chloride, dihydrate- 5kg-merck 102382-5KG None ناموجود Merck
66 Bsp1286 I (Sdu I) 1024A 500 Units ناموجود TaKaRa
67 Cobalt(II) chloride hexahydrate-100g- merck 102539-100g None ناموجود DUMMY
68 4th WHO International Standard for HBV DNA for NAT 10/266 None ناموجود NIBSC
69 FBS 10270-106 500ml ناموجود Gibco
70 Dimethyl Yellow 103055-10g None ناموجود Sigma
71 Restriction Enzyme Cpo l 1035A ناموجود TaKaRa
72 EcoT14I (StyI) 1038A 3,000 Units ناموجود TaKaRa
73 Formalin-2.5Lit-Merck 104002 None ناموجود Merck
74 EcoR I 1040A 10000 U ناموجود TaKaRa
75 EcoR V 1042A 3000u ناموجود TaKaRa
76 Restriction Enzyme EcoO109 l 1043A ناموجود TaKaRa
77 Fba I (Bcl I) 1045A 500units ناموجود TaKaRa
78 Fok I 1046A 1,000 Units ناموجود TaKaRa
79 L-Arabinose 25gr 10498 Acros ناموجود BioBasic
80 Hae III 1051A 4000Units ناموجود TaKaRa
81 1,1,1,3,3,3-Hexafluoro-2-propanol 105228-5G None ناموجود Sigma
82 Hae II 1052A 1000unit ناموجود TaKaRa
83 Hap II (Hpa II, Msp I) 1053A 2,000 Units ناموجود TaKaRa
84 آمونیاک 105426 2.5lit ناموجود Merck
85 Hha I 1056A 2,000 Units ناموجود TaKaRa
86 MR-VP broth-Merck 105712-500g None ناموجود Merck
87 HincII (HindII) 1059A 1,000 Units ناموجود TaKaRa
88 Methanol Merck 2.5 lit 106007 None ناموجود Merck
89 Methanol 106008 2.5lit ناموجود Merck
90 Methanol 106018 2.5lit ناموجود Merck
91 دی کلرو متان 106050 2.5lit ناموجود Merck
92 Hind III 1060A 10000 U ناموجود TaKaRa
93 HpaI 1064A 500 Units ناموجود TaKaRa
94 Kpn I 1068A 5000u ناموجود TaKaRa
95 Mfl I (Xho II) 1070A 500 Units ناموجود TaKaRa
96 PstI 1073A 10,000 Units ناموجود TaKaRa
97 Sac I 1078A 2000 U ناموجود TaKaRa
98 Sac II 1000u 1079A 1000u ناموجود TaKaRa
99 Sal I 1080A 3,000 Units ناموجود TaKaRa
100 Sau3AI (MboI) 1082A 200 Units ناموجود TaKaRa
101 Histopaque(ficoll) 10831 100ml ناموجود Sigma
102 Sma I 1085A 2000u ناموجود TaKaRa
103 گزیلول-2.5L-Merck 108661-2.5Lit None ناموجود Merck
104 گزیلول 108681 2.5lit ناموجود Merck
105 Spe I 1086A 300 units ناموجود TaKaRa
106 هماتوکسیلین-2.5L-Merck 109253-2.5Lit None ناموجود Merck
107 Xba I 1093A 3,000 Units ناموجود TaKaRa
108 Xho I 1094A 5000U ناموجود TaKaRa
109 Xsp I (Bfa I, Mae I) 1095A 500 Units ناموجود TaKaRa
110 2پروپانول Merck 2.5 lit 109634 None ناموجود Sigma
111 Afa I (Rsa I ) 1000 units 1116A 1000U ناموجود TaKaRa
112 (+)-JQ1 11187-5MG None ناموجود DUMMY
113 Eae I (Cfr I) 1123A 200 Units ناموجود TaKaRa
114 EcoO65I (BstEII, BstPI) 1135A 1,000 Units ناموجود TaKaRa
115 Sodium Pyrivate MEM 11360039 None ناموجود Invitrogen
116 Mbo II 1145A 400Units ناموجود TaKaRa
117 Biotin-SP-AffiniPure Goat Anti-Mouse IgG 115-065-006 None ناموجود DUMMY
118 Msp I (Hpa II) 1150A 3,000 Units ناموجود TaKaRa
119 Water HPLC grade 115333 2.5lit ناموجود Merck
120 Skim milk powder 115363 500g ناموجود Merck
121 Nae I 1155A 500Unit ناموجود TaKaRa
122 Nco l 1160A 500Unit ناموجود TaKaRa
123 Nde I 1161A 400u ناموجود TaKaRa
124 LIFE TECHNOLOGIES LIPOFECTAMINE REAGENT 0.3ML 11668-030 None ناموجود None
125 DNA Molecular Weight Marker VII. DIG-labeled 11669940910 None ناموجود Roche
126 Not I 1166A 500 U ناموجود TaKaRa
127 2.4 dinitrophenyl hydrazin* 11706 None ناموجود Sigma
128 Taq I 1189A 2000u ناموجود TaKaRa
129 VpaK11B I (Ava II) 1196A 300 Units ناموجود TaKaRa
130 Dpn I (Mal I) 1235A 1,000 Units ناموجود TaKaRa
131 Hinf I 1238A 6000U ناموجود TaKaRa
132 Nhe I 1241A 700U ناموجود TaKaRa
133 Pvu II 1243A 4,000 Units ناموجود TaKaRa
134 SphI 1246A 600u ناموجود TaKaRa
135 pOptiVEC™-TOPO® TA Cloning® Kit 12744-017 kit ناموجود Invitrogen
136 MS-275 13284-5mg None ناموجود DUMMY
137 Vindoline 13940871-10MG 10mg ناموجود Molekula
138 Vindoline 13940871-1MG None ناموجود Molekula
139 Hepatitis C virus (HCV) For nucleic acid amplification techniques (5th International standard 2015) 14/150 None ناموجود NIBSC
140 Non WHO Reference Material 4th HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques 14/290 None ناموجود NIBSC
141 Pen/Strep 20 ml Invitrogen 15140148 None ناموجود Invitrogen
142 Calsemid Invitrogen 10ml 15210-057 None ناموجود Invitrogen
143 15547 100 mg 15547 None ناموجود Cayman
144 ReadyStrip™ IPG Strips* 1632007 None ناموجود Biorad
145 ReadyStrip™ IPG Strips 1632008 None ناموجود None
146 100x BioLyte® 3/10 Ampholyte 1632094 1pack ناموجود Biorad
147 L-Isoleucine-500g- Acros 166175000 None ناموجود Acros
148 L-Isoleucine-250g- Acros 1661752500 None ناموجود Acros
149 Guanidine hydrochloride, biotech* 17577-25g None ناموجود Acros
150 Salicylic acid 17820272-1KG 1kg ناموجود Molekula
151 آلژنیک اسید 180947 100gr ناموجود Sigma
152 UREA pearls 98% 1KG 197460010 Acros ناموجود BioBasic
153 Urea-500g- Acros 19746-500g None ناموجود Acros
154 in vivo jetPEI Transfection Reagent (glucose inclus) 201-10G None ناموجود Poly Plus
155 T4 DNA Ligase 2011A 25000u ناموجود TaKaRa
156 Sodium phosphate, dibasic, anhydrous.SIZE 1kg 204850010-1kg None ناموجود Acros
157 Ammonium nitrate-1kg- Acros 205860010-1kg None ناموجود DUMMY
158 Sodium Molybdate- 100- Acros 206371000-100g None ناموجود Acros
159 Pro measure protein measurement solution 21011 None ناموجود Intron
160 DNA Polymerase I(E.coli) 2130A 500 Units ناموجود TaKaRa
161 Klenow Fragment 2140A 200unit ناموجود TaKaRa
162 Imidazole 21611083 500g ناموجود Molekula
163 Poly(A) Polymerase 2180A 20 Units ناموجود TaKaRa
164 Sodium deoxycholate-25g- Acros 21859-25g None ناموجود Sigma
165 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
166 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
167 Recombinant DNase I ,(RNase free) 2270A 1000u ناموجود TaKaRa
168 pvp 227545 100gr ناموجود Acros
169 Apigenin 22930039-1G ناموجود Molekula
170 SDS Acros 100g 23042 100g ناموجود Acros
171 Recombinant RNase Inhibitor 2313A 5000u ناموجود TaKaRa
172 Recombinant RNase Inhibitor 2313Q 500U ناموجود TaKaRa
173 1-Chloro-2,4-dinitrobenzene 237329 10g ناموجود Sigma
174 T7 RNA Polymerase 5000U 2540A 5000 U ناموجود TaKaRa
175 Grassofermata 1MG 26202-1mg None ناموجود Cayman
176 Exonuclease I 2650A 750 Units ناموجود TaKaRa
177 PrimeScript™ Reverse Transcriptase 2680A 10000u ناموجود TaKaRa
178 PrimeScript™ Reverse Transcriptase 2680Q 2000u ناموجود TaKaRa
179 Trichloroacetic acid 27071914-1KG 1kg ناموجود Molekula
180 Methacrylic anhydride 276685-500ML None ناموجود Sigma
181 DMEM/F-12, GlutaMAX™ supplement 31331-028 500ml ناموجود Invitrogen
182 Dextran from Leuconostoc spp.* 31390-25G None ناموجود Sigma
183 DMEM, powder, low glucose, pyruvate 31600-034 1lit ناموجود Invitrogen
184 DMEM powder 10 lit Low glucose 31600-083 10lit ناموجود Invitrogen
185 Thiometon in Shellsol 31681-250MG None ناموجود Sigma
186 Temozolomide 31724662-1G 1g ناموجود Molekula
187 RPMI 1640 Powder 1lit Invitrogen 31800-014 1lit ناموجود Invitrogen
188 Bifenazate 32504-50MG None ناموجود Sigma
189 Flonicamid 32509-25MG None ناموجود Sigma
190 pRl201-AN DNA 3264 ناموجود TaKaRa
191 T-Vector pMD20 3270 1 ug ناموجود TaKaRa
192 Vanillic acid (4-Hydroxy-3-methoxybenzoic acid) 32761487-100G 100g ناموجود Molekula
193 Maltose, monohydrate 329915000-500g None ناموجود Acros
194 (+)-Usnic acid 329967-5G None ناموجود Sigma
195 Acetic Acid 33209 2.5lit ناموجود Sigma
196 Chaperone Plasmid Set 3340 1 Set ناموجود TaKaRa
197 pCold DNA Cold Shock Expression System 3360 1 Set ناموجود TaKaRa
198 Ytterbium(III) chloride hexahydrate 337927-10G None ناموجود Sigma
199 200 bp DNA ladder 3410A 50 µg ناموجود TaKaRa
200 500 bp DNA ladder 3411A 50 µg ناموجود TaKaRa
201 Wide-range DNA ladder 0.8ml TaKaRa 3415A ناموجود TaKaRa
202 Parathion-methyl 36187-100MG None ناموجود Sigma
203 Sodium tetraborate decahydrate 367207 1Kg ناموجود Carlo
204 CellAmp™ Direct RNA Prep Kit for RT-PCR (Real Time) 3732 200 Rxns ناموجود TaKaRa
205 CellAmp™ RT-PCR for Direct Prep Kit (Real Time) & Protein Analysis 3733Q 25 preps ناموجود TaKaRa
206 Laccase  from  Trametes  versicolor 38429-1G None ناموجود Sigma
207 Propidium Iodide (PI) 40016 None ناموجود Biotium
208 dATP 4026 100 umol ناموجود TaKaRa
209 dGTP 4027 100 umol ناموجود TaKaRa
210 dCTP 4028 100 umol ناموجود TaKaRa
211 dTTP 4029 100 umol ناموجود TaKaRa
212 dNTP mixture 4030 1.28 ml ناموجود TaKaRa
213 dNTP Mixture 180 ul 4030 180ul ناموجود TaKaRa
214 Gel Red 41003 0.5ml ناموجود Biotium
215 ژلاتین-500g- Acros 410875000-500g None ناموجود Acros
216 2-Hydroxy-4?-(2-hydroxyethoxy)-2-methylpropiophenone 410896-10G None ناموجود Sigma
217 Nutrient Broth- Applichem 413793.1210-500g None ناموجود Acros
218 Paraformaldehyde 416782500 100gr ناموجود Acros
219 Safranin O 419211000-100G None ناموجود Acros
220 (+)-cat_numberechin 43412 10MG ناموجود Sigma
221 Thulium(III) chloride 439649-1G None ناموجود Sigma
222 Diazinon 45428-250MG None ناموجود DUMMY
223 Dinocap 45452-100MG None ناموجود Sigma
224 Carbazole 46100-250MG-R None ناموجود Sigma
225 Aspartame 47135 500mg ناموجود BioBasic
226 ProClin™ 300 48914-U None ناموجود Sigma
227 Curcumin 49256996-1g None ناموجود Molekula
228 Curcumin 49256996-25G 25g ناموجود Molekula
229 Curcumin 49256996-5g 5g ناموجود Molekula
230 لوله فالکون 15 استريل RNase & DNase Free بسته 50عددي 50015 None ناموجود SPL
231 RPMI 1640 Powder 1 lit Invitrogen 51800-019 1lit ناموجود Invitrogen
232 RPMI 1640 Powder 10lit Invitrogen 51800-035 10lit ناموجود Invitrogen
233 Resveratrol 51852282-1G 1g ناموجود Molekula
234 Ethanol BioUltra,for molecular biology 51976-1Lit None ناموجود Sigma
235 Gold(III)  chloride  trihydrate 520918-1G None ناموجود Sigma
236 Tannic acid 52612564-1KG 1Kg ناموجود Molekula
237 PE Streptavidin 554061 None ناموجود DUMMY
238 DNA Ligation Kit, Mighty Mix 6023 100 Rxns ناموجود TaKaRa
239 DNA Ligation Kit Mighty Mix (20 react) 6023Q ناموجود TaKaRa
240 cDNA synthesis kit: PrimeScript First Strand cDNA Synthesis Kit 6110A 50 Rxns ناموجود TaKaRa
241 3'-Full RACE Core Set 6121 20 react ناموجود TaKaRa
242 3'-Full RACE Core Set 6122 10 react ناموجود TaKaRa
243 PrimeScript II 1st strand cDNA synthesis kit 6210A Kit ناموجود TaKaRa
244 Lenti-X™ qRT-PCR Titration Kit 200 Rnx Clontech 631235 1kit ناموجود TaKaRa
245 Xfect Transfection Reagent 631316 None ناموجود TaKaRa
246 N-Ethylmaleimide 63480 None ناموجود Sigma
247 Real Time qPCR Master Mix - Terra qPCR Direct SYBR Premix 638319 ناموجود TaKaRa
248 1-Ethyl-3-methylimidazolium L-(+)-lactate 669512 5G ناموجود Sigma
249 فلاسک کشت سلول 25cm فيلتردار استريل بسته5 عددي 70025 None ناموجود SPL
250 فلاسک کشت سلول 75cm فيلتردار استريل بسته5 عددي 70075 None ناموجود SPL
251 Skim Milk Powder 70166-500G 500G ناموجود Sigma
252 HRV 3C Protease 500U 7360 None ناموجود TaKaRa
253 3.4-Dihydroxycinnamic acid (Caffeic acid) 77345158-10G ناموجود Molekula
254 Acrylamide 800830 1kg ناموجود Merck
255 4-CHLOROPHENOL 802254 100gr ناموجود Merck
256 دی متیل آمینو بنزآلدئید-100g-Merck 803057-100g None ناموجود Sigma
257 آمیل الکل-2.5L-Merck 822255-2.5Lit None ناموجود Merck
258 2.7-Dichlorodihydrofluorescein diacetate 85155-50MG None ناموجود Cayman
259 Quercetin 86015335-1G 1g ناموجود Molekula
260 Catharanthine 89985253-10MG 10mg ناموجود Molekula
261 Catharanthine 89985253-1MG None ناموجود Molekula
262 Hydroxyapatite 900193-50G None ناموجود Sigma
263 RNase-Free Water 9012 1ml ناموجود TaKaRa
264 RNase -Free Water-1ML 9012-1ML 1ML ناموجود TaKaRa
265 IPTG 9030 5gr ناموجود TaKaRa
266 X-Gal 9031 1gr ناموجود TaKaRa
267 DNA OFF 9036 500ml ناموجود TaKaRa
268 RNase - OFF 500 ml 9037 500ml ناموجود TaKaRa
269 E. coli HB101 Competent Cells 9051 Set ناموجود TaKaRa
270 GC Buffer I 9154 1.25ml ناموجود TaKaRa
271 Loading buffer 10 X 9157 vials ناموجود TaKaRa
272 Cell Counting Kit - 8 96992-100TESTS-F None ناموجود DUMMY
273 High Reverse Transcriptase (RNase H-, 10000 U) 9K-005-0005-10000U None ناموجود BioBasic
274 Alcian blue 8GX A0298 5gr ناموجود BioBasic
275 Potassium hydroxide A0566 1kg ناموجود Applichem
276 Albumin EIA and RIA grad A0850 500g ناموجود Applichem
277 Albumin A0850,0500 None ناموجود Applichem
278 Agar Bacteriology grade- Applichem A0949-500g None ناموجود Applichem
279 8-Anilino-1-naphthalenesulfonic  acid A1028-5G None ناموجود Sigma
280 Amyloid beta Protein Fragment 1-40 A1075-.1MG None ناموجود Sigma
281 Calcium Chloride dried, powdered pure A1428-0500 ناموجود Applichem
282 Streptavidin ultrapure A1495 1gr ناموجود Applichem
283 Streptavidin ultrapure A1495 1mg ناموجود None
284 Peptone from meat- Applichem A1835-500g None ناموجود Applichem
285 Acetyl coenzyme A sodium salt A2056 1MG ناموجود Sigma
286 D(+)-Xylose- Applichem A2241-100g None ناموجود Sigma
287 5-Azacytidine A2385 100MG ناموجود None
288 Amphotericin B solution A2942 100ml ناموجود Sigma
289 Peroxidase HRP A3615 None ناموجود Applichem
290 LB-Medium- Applichem A6666-500g None ناموجود Applichem
291 Acridine orange hemi salt A742007 10G ناموجود BioBasic
292 Acridine orange hemi salt A742007-5G None ناموجود BioBasic
293 Anti-Human IgG−Peroxidase antibody produced in rabbit A8792 2ml ناموجود Sigma
294 Amberlite™ IRN-77, ion exchange resin, Nuclear grade, Alfa Aesar™ AA1682136 - Alfa Aesar™ None ناموجود AlfaAesar
295 Acetylcholine chloride AB0002 25gr ناموجود BioBasic
296 Agarose M AB0013 250gr ناموجود BioBasic
297 Agarose B, low EEO AB0014 250gr ناموجود BioBasic
298 Agarose, Low melting gel AB0015 10gr ناموجود BioBasic
299 Agarose, Low melting gel.SIZE.25G AB0015-25G 25G ناموجود BioBasic
300 L-Asparagine monohydrate AB0017 100g ناموجود BioBasic
301 L-Ascorbic acid ( Vitamin C) AB0021 100G ناموجود BioBasic
302 Ampicillin, sodium salt USP AB0028 25gr ناموجود BioBasic
303 Ampicillin,sodium salt USP 5gr Ab0028-5g None ناموجود BioBasic
304 Nitrilotriacetic acid AB0055 100gr ناموجود BioBasic
305 Ampicillin, trihydrate AB0064 25G ناموجود BioBasic
306 Ammonium persulfate [APS] AB0072 25G ناموجود BioBasic
307 L-Arginine free base AB0205-10G 10g ناموجود BioBasic
308 L-Arginine free base AB0205-25G 25g ناموجود BioBasic
309 L-Arginine AB0205.SIZE.500G None ناموجود BioBasic
310 Normal Goat Serum Ab156046 None ناموجود َAbcam
311  N-Acetyl-L-Cysteine AB6697 25gr ناموجود BioBasic
312 Goat  Anti-Rabbit  IgG  H&L  (HRP) AB97069 ناموجود Sigma
313 ABTS , di ammonium salt AD0002 1gr ناموجود BioBasic
314 ACES AD0004 500gr ناموجود BioBasic
315 ACES AD0004-500G 500G ناموجود BioBasic
316 Adenosine AD0016 5gr ناموجود BioBasic
317 Adenosine AD0016 25G ناموجود BioBasic
318 L-Alanine .SIZE.25G AD0022-25G 25g ناموجود BioBasic
319 Albumin, heat shock isolation pH 7.0 AD0023 25gr ناموجود BioBasic
320 Amido black 10B AD0027 5gr ناموجود BioBasic
321 Amphotericin B AD0030P 5g ناموجود BioBasic
322 Avidin AD0068 5MG ناموجود BioBasic
323 Alizarin red S AD0144 25gr ناموجود BioBasic
324 Mupid One Submarine AD160 دستگاه ناموجود TaKaRa
325 Ammonium chloride ADB0034 500gr ناموجود BioBasic
326 Ammonium sulfate ADB0060 500gr ناموجود BioBasic
327 ترازو دقیق دیجیتالی (دقت یک صدم، ظرفیت 4000 گرم AGZ4000C دستگاه ناموجود None
328 TACCAAGAGAACTACATATCCGATGACCTTCCGTGGGGCCTAGTAGTTGCGGGACTACTAGACACTGTATGA apte zia-72bp None ناموجود BioBasic
329 Albumin, Protease Free AR2449 50gr ناموجود BioBasic
330 Rapid animal G-DNA AT4780 10prep ناموجود BioBasic
331 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 320 گرم) ATA320 دستگاه ناموجود None
332 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 520 گرم) ATA520 دستگاه ناموجود None
333 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 320 گرم) ATZ320 دستگاه ناموجود None
334 ترازو آنالیتیکال دیجیتالی سری AT (دقت یک هزارم، ظرفیت 520 گرم) ATZ520 دستگاه ناموجود None
335 Alkaline phosphatase Power AP AZ140A 1mg ناموجود BioBasic
336 Taq DNA Polymerase, 5U/UL B0089 200u ناموجود BioBasic
337 Taq DNA Polymerase, 5U/UL B0089(D0089) 1000u ناموجود BioBasic
338 TAQ DNA POLYMERASE, 5U/UL.SIZE.500U B0089(D0089)-500U None ناموجود BioBasic
339 T4 DNA LIGASE, 5U/UL.SIZE.200U B1125-200U None ناموجود BioBasic
340 bisBenzimide H 33258 B2883-25MG None ناموجود Sigma
341 Boric acid BB0044 500gr ناموجود BioBasic
342 D-Biotin BB0078 1gr ناموجود BioBasic
343 D-Biotin .SIZE.5G BB0078-5gr 5G ناموجود BioBasic
344 X-Gal BB0083 1gr ناموجود BioBasic
345 X-GLUC (X-GlcA) BB0085 25MG ناموجود BioBasic
346 Bacitracin zinc BB0113 25G ناموجود BioBasic
347 Bile salt BB0225-25G 25g ناموجود BioBasic
348 RNase H, 10U/UL BEN0202 500u ناموجود BioBasic
349 RNase I, 10U/UL BEN0601 1 Ku ناموجود BioBasic
350 10-175kDa Wide Range Protein Molecular Weight Marker, Prestained11 band: 10, 15, 20, 30, 40, 50, 60, 70, 95, 120, 175kDa BG00363 500ul ناموجود BioBasic
351 10-240kDa Wide Range 3 Color Prestained Protein Ladder BG00364 500UL ناموجود BioBasic
352 Mini gene synthesis 151bp with subcloning pUC57 BHV1 None ناموجود BioBasic
353 DMSO cell culture grade-7.5ml BI-1407 None ناموجود ایرانی
354 Low Range Protein Molecular Weight Marker BM201 30ul ناموجود BioBasic
355 Protein Marker, Mid Range, ready to use BM523 200ul (20 loadings) ناموجود BioBasic
356 14.4-98kDa Mid Range Protein Molecular Weight Marker BM524 200ul ناموجود BioBasic
357 0.2ML PCR TUBE, FLAT CAP BP541-S100 0.2ML ناموجود BioBasic
358 تیوب 5/0 میلی لیتر مخصوص PCRبدون رنگ با درب تخت دارای بسته بندی 1000تایی Rnase/DNase Free BP602-S100 بسته ناموجود BioBasic
359 تیوب 5/0 میلی لیتر مخصوص PCRبدون رنگ با درب تخت دارای بسته بندی 100تایی Rnase/DNase Free BP602-S100-1pak 100pcs ناموجود BioBasic
360 Mini gene synthesis 204bp with subcloning pUC57 BPI3 None ناموجود BioBasic
361 Mini gene synthesis 252bp with subcloning pUC57 BRSV None ناموجود BioBasic
362 EZ-10 Spin Column DNA Gel Extraction Kit BS354 100 preps ناموجود BioBasic
363 EZ-10 Spin Column PCR names Purificat_numberion Kit BS363 50preps ناموجود BioBasic
364 EZ-10 Cleanup Minipreps Kit BS367 50 PREPS ناموجود BioBasic
365 Mammalian Protease Inhibitor Cocktail, 100x Strength Solution BS386 1ml ناموجود BioBasic
366 EZ-RNA Reagents (Trizol) BS409A 25ML ناموجود BioBasic
367 EZ-RNA Reagents 10ml BS409A-10ML None ناموجود BioBasic
368 EZ-RNA Reagents (Trizol) BS410A 100ml ناموجود BioBasic
369 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS414 100 preps ناموجود BioBasic
370 EZ-10Spin Column Bacterial DNA Mini Preps Kit 50pr BS423-50 preps 50 preps ناموجود BioBasic
371 EZ-10 Spin Column animal DNA Mini-Preps Kit BS427 50preps ناموجود BioBasic
372 PCR Product Cloning Kit BS435-20 preps None ناموجود BioBasic
373 PCR Product Cloning Kit BS436-100PREPS None ناموجود BioBasic
374 Fast DNA Ligation Kit(5u/ul.T4) BS512-50 Rxn None ناموجود BioBasic
375 EZ-10 Spin Column Total RNA Mini-Preps Super Kit BS584 100preps ناموجود BioBasic
376 EZ-10 Spin Column Plasmid DNA Minipreps Kit BS614 250 preps ناموجود BioBasic
377 EZ-10 Spin Column DNA Gel Extraction Kit BS654 250 preps ناموجود BioBasic
378 EZ-10 Spin Column Animal Total RNA Mini-Preps Kit BS82312 50 preps ناموجود BioBasic
379 EZ-10 Spin Column Blood RNA Mini-Preps Kit BS82313 50preps ناموجود BioBasic
380 One-Tube Tissue DNA Extraction Kit BS8401 100 preps ناموجود BioBasic
381 One-Tube Clinical Sample DNA Extraction Kit.SIZE.100 Preps BS8403-100prep None ناموجود BioBasic
382 One-Tube Bacteria DNA Isolation Kit BS8413 100 PREPS ناموجود BioBasic
383 RNase-Free DNase Set BS88253-50 preps None ناموجود BioBasic
384 EZ-10 Spin Column Fungal RNA Mini-Preps Kit BS91915 50 PREPS ناموجود BioBasic
385 14.4-116kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0431 1ml ناموجود BioBasic
386 14.4-116kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0431 2x1ml ناموجود BioBasic
387 20-120kDa Mid Range Protein Molecular Weight Marker, Prestained BSM0441 250UL ناموجود BioBasic
388 20-120kDa Mid Range Protein Molecular Weight Marker, Prestained BSM0441-250UL ناموجود BioBasic
389 10-200kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0661 2x250ul ناموجود BioBasic
390 10-200kDa Wide Range Protein Molecular Weight Marker, Unstained BSM0661-250ul 250ul ناموجود BioBasic
391 10-170kDa Wide Range Protein Molecular Weight Marker, Prestained BSM0671 2x250ul ناموجود BioBasic
392 10-170kDa Wide Range Protein Molecular Weight Marker, Prestained BSM0671-250ul 250ul ناموجود BioBasic
393 Total Protein Extraction Kit BSP003 50preps ناموجود BioBasic
394 0.1-10ul Micro Tips, Short,1000/Pack,Sterile BT215 1000Pack ناموجود BioBasic
395 سرسمپلرکریستالی کوتاه (10-0.1 میکرو لیتر) استریل Rnase/DNase Free بسته هزار عددی BT215-S بسته هزار عددی ناموجود BioBasic
396 سر سمپلر آبی (1000-100میکرولیتر) استریل بدون Rnase/DNase Free رنگ بسته هزار عددی BT222-NS بسته هزار عددی ناموجود BioBasic
397 سر سمپلر زرد (200 میکرو لیتر) مدرج استریل بدون رنگ بسته هزار عددی Rnase/DNase Free BT224-NS بسته ناموجود BioBasic
398 رک سر سمپلر زرد (200 میکرو لیتر) مدرج استریل Rnase/DNase Free بدون رنگ BT224-RS Rack ناموجود BioBasic
399 سرسمپلر 300میکرولیتر، استریل  Rnase/DNase Free BT330-NS 1000 pcs ناموجود BioBasic
400 Rapid Blood RNA Isolation Kit BT4182 10preps ناموجود BioBasic
401 Rapid Blood DNA Extraction Kit BT4782 50preps ناموجود BioBasic
402 فالکون 15 BT888-SN بسته 100 تایی ناموجود BioBasic
403 15ML Centrifuge Tube, Screw Cap, Red, Sterile, 100/Bag BT888-SR SR ناموجود BioBasic
404 15ML Centrifuge Tube, Screw Cap, Yellow, Sterile, 100/Bag BT888-YS 100pcs ناموجود BioBasic
405 ترازو دقیق دیجیتالی (دقت یک صدم، ظرفیت 2100 گرم BTA2100D دستگاه ناموجود None
406 ترازو دقیق دیجیتالی (دقت یک هزارم، ظرفیت 210 گرم BTA210D دستگاه ناموجود None
407 Mini gene synthesis 185bp with subcloning pUC57 BVDV1 None ناموجود BioBasic
408 Mini gene synthesis 193bp with subcloning pUC57 BVDV2 None ناموجود BioBasic
409 Caffeine C0150 100gr ناموجود BioBasic
410 (−)-cat_numberechin C0567 5MG ناموجود Sigma
411 (±)-cat_numberechin hydrate C1788 500MG ناموجود Sigma
412 Cesium chloride         C3032 25gr ناموجود BioBasic
413 Acetylcholinesterase from Electrophorus electricus (electric eel) C3389 2KU ناموجود Sigma
414 Acetylcholinesterase from Electrophorus electricus (electric C3389-500U ناموجود None
415 Water C8801 500ml ناموجود BioBasic
416 Cyanogen bromide-activated-Sepharose® 4B 1g Sigma C9142 None ناموجود Sigma
417 Calcium nitrate tetrahydrate, extra pure Ca(NO3)2·4H2O CA0230 1kg ناموجود Scharlau
418 Coomassie brilliant blue R-250    CB0037 25gr ناموجود BioBasic
419 Citric acid CB0055 1Kg ناموجود BioBasic
420 L-Cysteine CB0088-500g None ناموجود BioBasic
421 CTAB CB0108 100g ناموجود BioBasic
422 L-Cysteine CB0132-500g None ناموجود BioBasic
423 CELLBANKER 1plus CB022  20ml ناموجود TaKaRa
424 Calcium phosphate, tribasic CB0263 250gr ناموجود BioBasic
425 CELLBANKER 2 CB032  20ml ناموجود TaKaRa
426 Curcumin CB0346 5gr ناموجود BioBasic
427 Cytochrome C CB0354-100MG 100G ناموجود BioBasic
428 STEM-CELLBANKER CB042  20ml ناموجود TaKaRa
429 STEM-CELLBANKER CB044S  4ml ناموجود TaKaRa
430 STEM-CELLBANKER GMP grade CB047 4*20 ml ناموجود TaKaRa
431 Chlorocholine chloride CB0736 5G ناموجود BioBasic
432 Cresol red, free acid CD0037B 5gr ناموجود BioBasic
433 Calcium chloride, dihydrate CD0050-2.5kg 2.5kg ناموجود BioBasic
434 Calcium chloride, dihydrate CD0050-500G 500gr ناموجود BioBasic
435 Cholesterol CD0122 50gr ناموجود BioBasic
436 Cytosine CD0138 10gr ناموجود BioBasic
437 Histagged CD19 FITC conjugated CD9-HF2H2-25ug None ناموجود DUMMY
438 Copper (II) sulfate pentahydrate CDB0063-400g ناموجود BioBasic
439 Carbenicillin disodium CDJ469.SIZE.5G 5G ناموجود BioBasic
440 CASEIN CN5204 500gr ناموجود BioBasic
441 Supelco 37 Component FAME Mix CRM47885 None ناموجود DUMMY
442 Polynuclear Aromatic Hydrocarbons Mix CRM48905 None ناموجود DUMMY
443 تیوب ml50با درب بدون رنگ مخصوص سرعت بالا، استریل/بسته 25تایی  Rnase/DNase Free CT790-SN 25pcs ناموجود BioBasic
444 Agarose A D0012-250gr 250gr ناموجود BioBasic
445 Albumin,pH 5.1+0. D0024 50gr ناموجود BioBasic
446 Albumin,pH 5.1+0.2 10gr D0024-10G 10G ناموجود BioBasic
447 Albumin,pH 5.1+0.2 25gr D0024-25G 25G ناموجود BioBasic
448 Albumin, pH 5.1+0.2 5gr D0024-5G 5G ناموجود BioBasic
449 2'-Deoxythymidine-5'-triphosphate 100mM solution[dTTP], sodium salt D0046T 0-5ml ناموجود BioBasic
450 TSG DNA POLYMERASE, 5U/UL.SIZE. 200 u D0081-200u None ناموجود BioBasic
451 Dialysis tubing cellulose membrane23mm غشاء دیالیز با قطر 23mm (Molecular weight cut-off : 12400Da) D0405 1meter ناموجود Sigma
452 Dialysis tubing cellulose membrane32mm غشاء دیالیز با قطر 32mm (Molecular weight cut-off : 12400Da) D0530 Meter ناموجود Sigma
453 Dialysis tubing cellulose membrane32mm غشاء دیالیز با قطر 32mm (Molecular weight cut-off : 12400Da) D0530 1meter ناموجود Sigma
454 1,4-Diaminobutane D13208 100gr ناموجود Sigma
455 Diphenyl phosphite D210803 100gr ناموجود Sigma
456 Dimethyl sulfoxide (DMSO) Cell Culture Grade D2650-10ML 10ml ناموجود Sigma
457 2.5 dibromoterephthalic acid 5G D3994-5g None ناموجود DUMMY
458 Dansyl chloride D705183 1G ناموجود BioBasic
459 Dialysis tubing cellulose membrane10mm غشاء دیالیز با قطر 10mm (Molecular weight cut-off : 14KDa) D9277 1meter ناموجود None
460 Dialysis tubing cellulose membrane43mm غشاء دیالیز با قطر 43mm (Molecular weight cut-off : 14KDa) D9527 1meter ناموجود Sigma
461 DAB, tetra hydrochloride DB0140 5gr ناموجود BioBasic
462 DAB, tetra hydrochloride DB0140 25gr ناموجود BioBasic
463 DEPC DB0154-0.125ML None ناموجود DUMMY
464 Dextran sulfate DB0160 10g ناموجود BioBasic
465 Sodium chloride DB0483 2.5kg ناموجود BioBasic
466 Sodium azide DB0613 100gr ناموجود BioBasic
467 Doxycycline, hydrochloride DB0889 25gr ناموجود BioBasic
468 Deoxycholic acid, sodium salt DD0150 50G ناموجود BioBasic
469 DEPC Water DD1005 500ml ناموجود BioBasic
470 DNAfectamine DNAF001-0.1ML None ناموجود BioBasic
471 Eco-Stain . ready to use DT81413-1 ML 1ML ناموجود BioBasic
472 Eco Green-DNA Dye ,ready to use 1.5ml DT81414-1.5ml 1.5ml ناموجود BioBasic
473 Eco-Red-DNA Dye . Ready to use DT81415-1 ML 1ML ناموجود BioBasic
474 Botulinum Neurotoxin Type A DuoSet ELISA DY4489-05 None ناموجود DUMMY
475 Benzonase® Nuclease E1014 5ku ناموجود Sigma
476 Benzonase® Nuclease E1014 25ku ناموجود Sigma
477 Ethylenediaminetetraacetic acid tetrasodium salt dihydrate E6511-100g None ناموجود DUMMY
478 Elastase from human leukocytes E8140-1UN None ناموجود Sigma
479 EDTA , disodium salt , dihydrate EB0185 500gr ناموجود BioBasic
480 EDTA, disodium salt, dihydrateSIZE.100G EB0185-100G 100g ناموجود BioBasic
481 Ethidium bromide (EB; EtBr) EB0195 1gr ناموجود BioBasic
482 EDAC, hydrochloride EB0433 25g ناموجود BioBasic
483 EDAC, hydrochloride.SIZE.5G EB0433-5G 5g ناموجود BioBasic
484 Ethyl acetate Reagent EC4600 1lit ناموجود Sigma
485 Ethylene glycol ED0199 250ml ناموجود BioBasic
486 Alu I ER0011 600U ناموجود Thermo
487 Thermo Scientific™ PstI (10 U/µL) ER0611 None ناموجود Thermo
488 MnlI ER1071 None ناموجود Thermo
489 Freund’s Adjuvant, InComplete F5506 10ml ناموجود BioBasic
490 Fluorescein  diacetate F7378-10G None ناموجود None
491 Agar A FB0010-500G 500G ناموجود BioBasic
492 Formamide deionized FB0211-500ml None ناموجود BioBasic
493 Fast Green FCF FB0452 5gr ناموجود BioBasic
494 Iron(II) sulfate . heptahydrate FB0461-500g None ناموجود BioBasic
495 کرایوتیوب 1.8 استریل بسته20عددی jetbiofil کانادا FCT312020 None ناموجود Jetbiofil
496 Iron (III) sulfate, hydrate FD0208 250gr ناموجود BioBasic
497 Thermo Scientific™ FastDigest™ Bsp1407I FD0933 None ناموجود Thermo
498 Formamide FDB0212 500ml ناموجود BioBasic
499 Formononetin 100 mg FF09317-100mg None ناموجود Carbosynth
500 Sorafenib tosylate 500 mg FS10808 None ناموجود Carbosynth
501 رک سرسمپلرفیلتردار10-1/0 میکرو لیتراستریل رک 96 عددی  Rnase/DNase Free FT215-RNS رک 96 عددی ناموجود BioBasic
502 سرسمپلر فیلتردار شفاف –سایز 1000-100میکرولیتر بسته 1000 عددی FT222 1000pcs ناموجود BioBasic
503 سرسمپلرفیلتردار100-10  میکرو لیتر بسته 1000 عددی FT224 1000pcs ناموجود BioBasic
504 10-100UL Filter Tip, Natural, Sterile, 96/Rack FT224-RNS رک 96 عددی ناموجود BioBasic
505 0.5-10UL FILTER TIP, NATURAL,1000/PACK FT225 ناموجود BioBasic
506 Gluglutaraldehyde G0875 25ml ناموجود BioBasic
507 Yeast Extract G0961 500gr ناموجود BioBasic
508 Agar C G1253 500G ناموجود BioBasic
509 Tryptone Powder G211(TG217) 100gr ناموجود BioBasic
510 TRYPTONE POWDER .SIZE.500G G211(TG217)-500 G 500g ناموجود BioBasic
511 Peptone B SOY Protein G214 500G ناموجود BioBasic
512 Peptone B SOY Protein G214-100G 100G ناموجود BioBasic
513 Peptone F Lactalbumin Hydrolysate G256 500G ناموجود BioBasic
514 Guanidine Oxidized* G4375-1g None ناموجود Sigma
515 Gelatin from bovine skin G9382-1KG None ناموجود Sigma
516 Gelatin G9764 100gr ناموجود BioBasic
517 Gelatin.SIZE.50G G9764-50G 50g ناموجود BioBasic
518 D(+)Galactose GB0215 25gr ناموجود BioBasic
519 D-Glucose, monohydrate GB0218 500gr ناموجود BioBasic
520 D-Glucose, anhydrous Gb0219 1KG ناموجود BioBasic
521 Glutathione oxidized GB0228 1g ناموجود BioBasic
522 Glutathione reduced GB0229 5gr ناموجود BioBasic
523 Glutathione reduced GB0229 1gr ناموجود BioBasic
524 Glycerol GB0232 500ml ناموجود BioBasic
525 Glycerol SIZE.400ML GB0232-400ml None ناموجود BioBasic
526 glycine GB0235 2.5K ناموجود BioBasic
527 Guanidine hydrochloride, biotech GB0242 100gr ناموجود BioBasic
528 Guanidine hydrochloride, biotech GB0242 500G ناموجود BioBasic
529 Guanidine hydrochloride, reagent GB0243 500G ناموجود BioBasic
530 Guanidine thiocyanate, biotech GB0244 250G ناموجود BioBasic
531 Guanidine thiocyanate, biotech GB0244 1KG ناموجود BioBasic
532 Glycogen GB0301 1gr ناموجود BioBasic
533 Guanine GD0246 25gr ناموجود BioBasic
534 G 418 sulfate GDJ958 1gr ناموجود BioBasic
535 Guanidine thiocyanate, ultra pure.SIZE.1KG GDR0244 1KG ناموجود BioBasic
536 Guanidine thiocyanate, ultra pure.SIZE.250G GDR0244 None ناموجود None
537 Amersham™ Hybond® P Western blotting membranes, PVDF GE10600021 1ea ناموجود Sigma
538 DEAE Sepharose® Fast Flow GE17-0709-10 25ml ناموجود GE Health Care
539 Percoll® PLUS GE17-5445-02 None ناموجود GE Health Care
540 Gene synthesis 336bp Gene Synthesis AMINO073 None ناموجود BioBasic
541 ECL™ Western Blotting Detection GERPN2209 Kit ناموجود None
542 Low MW DNA Marker A ready touse25,50,75,100,150,200,300,400,500bp GM303 20 loading ناموجود BioBasic
543 25-500bp Low Range DNA Marker A, Ready-to-use GM303-20 loading None ناموجود BioBasic
544 DNA Marker B, Ready-to-use 100-600bp Low Range DNA Marker B, Ready-to-Use 6 DNA fragments: 100, 200, 300, 400, 500, 600bp GM331 50 Loading ناموجود BioBasic
545 دسته هاون خردکننده بافت، مخروطی شکل GR111 100 loading ناموجود BioBasic
546 Adenovirus Fiber monomer and trimer antibody [4D2] GTX23233 None ناموجود Genetex
547 AR monoclonal antibody (M04), clone 3D10 H00000367-M04-100ug None ناموجود Abnova
548 CASP3 (Human) Recombinant Protein (P01) H00000836 P01-10ug ناموجود Abnova
549 IFNB1 purified MaxPab rabbit polyclonal antibody (D01P) H00003456 D01P-100ug ناموجود Abnova
550 TRAF6 monoclonal antibody (M02), clone 1B2 H00007189 M02-50ug ناموجود Abnova
551 IL1R2 monoclonal antibody (M01), clone 1G12 H00007850 M01-100ug ناموجود Abnova
552 Hanks , Balanced Salts,Powder H2387 1lit ناموجود Sigma
553 6-Hydroxydopamine hydrochloride H4381 100mg ناموجود Sigma
554 Oligo synthesis HAP Purification OD2 H510001-0002 None ناموجود BioBasic
555 HEPES free acid SiZE.25gr HB0264 ناموجود BioBasic
556 HEPES, sodium salt HB0265 1KG ناموجود BioBasic
557 Histamine dihydrochloride HB0501 5gr ناموجود BioBasic
558 N-Hydroxysuccinimide HB0526 25G ناموجود BioBasic
559 N-Hydroxysuccinimide HB0526-10g 10g ناموجود BioBasic
560 N-Hydroxysuccinimide HB0526-20g ناموجود BioBasic
561 HCL -500ml-Acros HCL -500ml-Acros 500ml ناموجود BioBasic
562 8-Hydroxyquinoline (8-Quinolinol) HD0274 100G ناموجود BioBasic
563 L-Histidine, monohydrochloride, HE806-10G 10g ناموجود BioBasic
564 5X All-In-One RT MasterMix (50ul) HRT025-10.25RXNS None ناموجود BioBasic
565 5X All-In-One RT MasterMix (200ul) HRT100-10.100RXNS None ناموجود BioBasic
566 5X All-In-One RT MasterMix (400ul) HRT200-10.SIZE.200 None ناموجود BioBasic
567 ADH1 (Exherin) 10MG HY-13541 None ناموجود DUMMY
568 Telmisartan 50MG HY-13955 None ناموجود DUMMY
569 Docetaxel 100MG HY-B0011 None ناموجود DUMMY
570 4- Isothiocyanatophenyl α-D- Mannopyranoside I905135 100mg ناموجود TRC
571 Ice Pack IB003 Pack ناموجود BioBasic
572 IPTG IB0168 25gr ناموجود BioBasic
573 IPTG IB0168-100G 100g ناموجود BioBasic
574 Imidazole IB0277 100g ناموجود BioBasic
575 Imidazole IB0277 500g ناموجود BioBasic
576 myo-inositol IB0536.SIZE.500G None ناموجود BioBasic
577 Iodoacetamide IB0539 5gr ناموجود BioBasic
578 ICE PACK ICE None ناموجود BioBasic
579 Gene synthesis 1683bp AMINO070 J508021-0001 None ناموجود BioBasic
580 Subcloning Service pCDH-CMV J508022-0001 None ناموجود BioBasic
581 Kanamycin sulfate -1gr K4000 None ناموجود Sigma
582 Keratinase K4519-500UN None ناموجود None
583 TNF (Human) ELISA Kit KA0191 1Kit ناموجود Abnova
584 Il6 (Rat) ELISA Kit KA0278 kit ناموجود Abnova
585 Tnf (Rat) ELISA Kit KA0280 1 Kit ناموجود Abnova
586 Bdnf (Mouse) ELISA Kit KA0331 1 Kit ناموجود Abnova
587 MMP2 (Human) ELISA Kit KA0391 kit ناموجود Abnova
588 Annexin V-FITC Apoptosis Kit KA0714 1 Kit ناموجود Abnova
589 Annexin V-FITC Apoptosis Kit (Premium) using SYTXO green dye and annexin V-FITC for apoptosis detection. KA0715 1 Kit ناموجود Abnova
590 Caspase-1 Assay Kit (Colorimetric) KA0727 None ناموجود Abnova
591 Caspase-3 Assay Kit (Colorimetric) KA0740 kit ناموجود Abnova
592 LDH-Cytotoxicity Assay Kit KA0785 1Kit ناموجود Abnova
593 Ammonia Assay Kit KA0810 1Kit ناموجود Abnova
594 Glucose Assay Kit KA0831 1Kit ناموجود Abnova
595 Thioredoxin Reductase Assay Kit KA0883 None ناموجود Abnova
596 Senescence Detection Kit KA0899 None ناموجود Abnova
597 JC-1 Mitochondrial Membrane Potential Assay Kit KA1324 None ناموجود Abnova
598 MTT Cell Viability Assay Kit KA1606 Kit ناموجود Abnova
599 ATPase/GTPase Assay Kit KA1610 1Kit ناموجود Abnova
600 CXCL16 (Human) ELISA Kit KA2186 None ناموجود Abnova
601 SERPINE1 (Human) ELISA Kit KA3102 None ناموجود Abnova
602 Caspase Substrate Assay Kit (Colorimetric) KA3694 Kit ناموجود Abnova
603 PLAT (Human) ELISA Kit KA3834 None ناموجود Abnova
604 Arg8-Vasopressin ELISA Kit KA4582 None ناموجود Abnova
605 IL8 (Human) ELISA Kit KA4806 None ناموجود Abnova
606 Kanamycin sulfate 1g KB0286-1G None ناموجود BioBasic
607 Kanamycin sulfate 700mg KB0286-700mg None ناموجود BioBasic
608 a-2-Ketoglutaric acid, disodium salt, dihydrate KD0289 100gr ناموجود BioBasic
609 Lipopolysaccharides from Escherichia coli O111:B4 L2630-10MG None ناموجود Sigma
610 Luteinizing Hormone from sheep pituitary L5269 Vial ناموجود Sigma
611 Lactoperoxidase from Bovine Milk L8257 25mg ناموجود Sigma
612 L-Lysine, monohydrochloride LB0171 250gr ناموجود BioBasic
613 Lithium dodecyl sulfate LB0569 25G ناموجود BioBasic
614 L-Leucine LB0922 500G ناموجود BioBasic
615 L-Leucine LB0922 100gr ناموجود BioBasic
616 Light green SF, Yellowish LD0007 25g ناموجود BioBasic
617 Lithium chloride, anhydrous LDB0307 250gr ناموجود BioBasic
618 Lysozyme LDB0308 100G ناموجود BioBasic
619 Lithium nitrate-Acros-250G Lithium nitrate-Acro 250G ناموجود BioBasic
620 BIOTIN-PROTEIN L M00097 None ناموجود DUMMY
621 Bst DNA Polymerase M0275S None ناموجود DUMMY
622 500-10000bp DNA Marker, Ready-to-use M101R-1 SIZE.100 loading None ناموجود BioBasic
623 100 bp-10 Kb Wide Range DNA Logical Marker, Ready to use16 D M103R-1 100 LOADING ناموجود BioBasic
624 DNA Marker Wide Range,Ready to use (100bp-10Kb) M103R-1 100 loading ناموجود BioBasic
625 100bp-1.5kb DNA Ladder Marker J4 ready to use 100,200,300,400,500,600,700,800,900,1000,1500bp M107R-1 100 Loading ناموجود BioBasic
626 100-1500bp DNA Marker, Ready-to-use M107R-1.Size.100 loadings None ناموجود BioBasic
627 MTT M2128 1gr ناموجود Sigma
628 Myricetin 500MG M2131-500MG None ناموجود Sigma
629 erpes simplex virus type 1/2 gD monoclonal antibody, clone HA025 MAB13574-100ug None ناموجود Abnova
630 Herpes simplex virus type 1 ICP0 monoclonal antibody, clone H1A027 MAB13583-100ug None ناموجود Abnova
631 Herpes simplex virus type 1 ICP4 monoclonal antibody, clone H1A021 MAB13584-100ug None ناموجود Abnova
632 CEA monoclonal antibody MAB1393-1mg None ناموجود Abnova
633 HSP70/HSP90AA1 monoclonal antibody,clone BB70 MAB2196 100ug ناموجود Abnova
634 MYD88 monoclonal antibody, clone 2E9C2 MAB2745 100ug ناموجود Abnova
635 Clostridium tetani Tetanus toxin monoclonal antibody, clone TetH6 MAB2884-200ug None ناموجود Abnova
636 Clostridium botulinum Toxin A monoclonal antibody, clone B36 MAB4095 1mL ناموجود Abnova
637 Clostridium botulinum Toxin B monoclonal antibody, clone B36 MAB4096 1mL ناموجود Abnova
638 IL1R1 monoclonal antibody, clone BDI204 MAB4240 200ug ناموجود Abnova
639 Escherichia coli O157:H7 monoclonal antibody MAB5413 100ug ناموجود Abnova
640 5-Methylcytosine monoclonal antibody, clone 5MC-CD MAB6766 100ug ناموجود Abnova
641 MOPSO, free acid MB0234 25gr ناموجود BioBasic
642 Magnesium chloride, hexahydrate MB0328 500gr ناموجود BioBasic
643 Magnesium sulfate, heptahydrate, ACS MB0329 500G ناموجود BioBasic
644 D-Mannitol MB0335 500G ناموجود BioBasic
645 b-Mercaptoethanol MB0338 100ml ناموجود BioBasic
646 MES, free acid, monohydrate MB0341-100G 100g ناموجود BioBasic
647 MES, free acid, monohydrate MB0341-500G 500g ناموجود BioBasic
648 Methylene blue, chloride, trihydrate MB0342 250G ناموجود BioBasic
649 L-Methionine MB0346-10G 10g ناموجود BioBasic
650 L-Methionine MB0346-5G 5g ناموجود BioBasic
651 MOPS, free acid MB0360 100gr ناموجود BioBasic
652 MOPS, free acid MB0360-500G 500G ناموجود BioBasic
653 Melatonin MB0605 25G ناموجود BioBasic
654 MES, sodium salt MB0611 50gr ناموجود BioBasic
655 25mM MgCl2 MB1193 1.5ml ناموجود BioBasic
656 D-(+) Maltose, monohydrate MB4950 100G ناموجود BioBasic
657 Methanol MC6700 500ml ناموجود BioBasic
658 Mitomycin C MD0356M 10mg ناموجود BioBasic
659 MOPS, sodium salt MDB360S 100gr ناموجود BioBasic
660 MOPS, sodium salt MDB360S-25g None ناموجود BioBasic
661 Lambda DNA MDD22 100ug ناموجود BioBasic
662 Gibco™ EpiLife™ Medium. with 60µM calcium MEPI500CA None ناموجود Thermo
663 Gibco™ EpiLife™ CF Kit MEPICF500 None ناموجود Thermo
664 Maltose, monohydrate MIB1184 500G ناموجود BioBasic
665 Maltose, monohydrate MIB1184 100g ناموجود BioBasic
666 Premix WST-1 Cell Proliferation Assay System MK400 2500test ناموجود TaKaRa
667 LDH Cytotoxicity Detection Kit MK401 2,000 Tests ناموجود TaKaRa
668